About
Published on behalf of the International Federation for Cell Biology
| Cancer |  |
Cell death | |
Cell cycle | |
Cytoskeleton | |
Exo/endocytosis | |
Differentiation | |
Division | |
Organelles | |
Signalling | |
Stem cells | |
Trafficking |
|
|
Cell Biology International (2005) 29, 15–19 (Printed in Great Britain)
Production of transgenetic sugarbeet (Beta vulgaris L.) plants resistant to phosphinothricin
E.M. Kishchenko*, I.K. Komarnitskii and N.V. Kuchuk
Institute of Cell Biology & Genetic Engineering Natl. Acad. Sci. of Ukraine, 148 Zabolotnogo Str., Kyiv 03143, Ukraine
Abstract A method of Agrobacterium-mediated genetic transformation of sugarbeet (Beta vulgaris L.) with vacuum infiltration has been developed. Aseptic 3-weeks old etiolated seedlings of two diploid O-type sugarbeet lines (KS3 and KS7) have been used for genetic transformation. Transgenic sugarbeet plants carrying the reporter β-glucuronidase gene have been selected for their resistance to glufosinate ammonium herbicide. Integration of transgenes into sugarbeet genome was confirmed with GUS assay and PCR using primers for bar and gusA genes. Keywords: Beta vulgaris L., Sugarbeet, Regeneration, Transformation, Agrobacterium tumefaciens. *Corresponding author. 1 Introduction Sugarbeet (Beta vulgaris L.) is a commercially important sucrose-producing crop particularly in temperate zones. The availability of transgenic herbicide resistant sugarbeet would improve weed control and increase profitability of this culture. Despite considerable progress has been made during last decade for introduction of foreign genes into crops sugarbeet still remains recalcitrant for genetic transformation. There are several reports on Agrobacterium tumefaciens-mediated transformation (Lindsey and Gallois, 1990; D'Halluin et al., 1992a,b; Krens et al., 1996, Snyder et al., 1999, Hisano et al., 2004), particle bombardment method (Snyder et al., 1999) and only one publication concerning protoplast-based transformation system of sugarbeet (Hall et al., 1996). The present work describes Agrobacterium-mediated genetic transformation system for O-type diploid sugarbeet lines used to maintain cytoplasmic male sterile (CMS) lines involved into hybrid breeding. We have used developed protocol to obtain transgenic sugarbeet plants resistant to glufosinate ammonium herbicide (phosphinothricin, PPT). Phosphinothricin is irreversible inhibitor of glutamine synthase, which plays a central role in assimilation of ammonia and in regulation of nitrogen metabolism in plants. Application of PPT leads to several immediate metabolic dysfunctions and plant death. bar gene encodes phosphinothricin acetyl transferase (PAT), that inactivates the herbicide by acetylation. Stable introduction of bar gene into crop genome has yielded plant resistant to this herbicide. Transgenic herbicide resistant sugarbeet plants were analysed by ensymatic assay and molecular analysis. 2 Materials and methods 2.1 Agrobacterium strain and plasmids A. tumefaciens nopaline strain GV3101 harboring the binary vector pICBV19 was used. T-DNA region pICBV19 contains phosphinothricin acetyl transferase gene (bar) with nopaline synthase (nos) promoter and octopine synthase (ocs) terminator and β-glucuronidase gene (gusA) with CaMV35S promoter and nopaline synthase terminator. Binary vector pICBV19 was provided by Icon Genetics GmbH (Halle, FRG). The bacteria were grown in LB medium (Sambrook et al., 1989) containing 50 2.2 Plant material Two diploid O-type sugarbeet lines (B. vulgaris L.) were used: KS3 and KS7. Seeds were kindly provided by Prof. F.M. Parij (Institute of Sugarbeet, Kiev, Ukraine). Sugarbeet seeds were incubated at +4 Friable callus was induced from hypocotyl and cotyledon explants on MS15B2 medium in the dark. Callus was cultured in the liquid MS medium by adding 2 2.3 Transformation and regeneration Suspension cell culture and aseptic 3-weeks old etiolated seedlings were utilized as starting material for genetic transformation of sugarbeet. Two-day agrobacterial culture was centrifuged at 4000g and resuspended with equal volume of solution containing 440 Aseptic etiolated seedlings of sugarbeet were used for Agrobacterium-mediated transformation in the same way as cells of suspension culture. After vacuum infiltration, seedlings were transferred to sterile filter paper and incubated in the dark at 22–24 2.4 GUS assay β-Glucuronidase activity in transformed plant tissues was detected as described by Wozniak and Owens (1994) with modification proposed by Krens et al. (1996). Tissues were stained for 12 2.5 PCR analysis Total plant DNA for polymerase chain reaction (PCR) was extracted as described by Cheung et al. (1993). Sequences 5′GGCCCCAATCCAGTCCATTAATGCG and 3′TGGGTGGACGATATCACCGTGGTGA were used for gus gene amplification. The probes amplified 423-bp fragment. For bar genes the use of primers 5′ATGAGCCCAGAACGACGCCCGGCC and 3′GCATGCGCACGGTCGGGTCGTTGG, resulted in a 414-bp amplificate. Cycling was carried out according to the following conditions: denaturation at 94 3 Results and discussion Routine transformation system of plants requires cell cultures competent for efficient plant regeneration as well as an effective method of gene delivery. A. tumefaciens remains the preferred tool in genetic transformation of plants. The advantageous features of Agrobacterium-mediated transformation include transfer of relatively large segments of DNA with defined ends and with minimal rearrangement, integration of small numbers of gene copies into plant chromosomes, and high quality and fertility of resultant transgenic plants. Although sugarbeet is susceptible to Agrobacterium infection (Paul et al., 1987; Krens et al., 1988) efficiency of further regeneration is low and genotype dependent. Moreover shoots regenerated from deeply buried cells, which are inaccessible for agrobacteria (D'Halluin et al., 1992a). In this connection, we have used the vacuum infiltration of plant tissues for delivery of agrobacteria (Kapila et al., 1997). A well-defined, preferably simple shoot regeneration protocol is a prerequisite for production of transgenic plants. Direct organogenesis in sugarbeet is less genotype dependent (Detrez et al., 1989; Jacq et al., 1992; Toldi et al., 1996) than indirect regeneration and regenerated plants show more genetic stability (Detrez et al., 1989). Direct shoot regeneration was observed from various sugarbeet explants including petioles and leaves (Saunders and Doley, 1986; Detrez et al., 1988; Freytag et al., 1988; Krens and Jamar, 1989), shoot bases (Lindsey and Gallois, 1990, Hisano et al., 2004), cotyledons (Krens et al., 1996; Joersbo et al., 1999; Snyder et al., 1999), hypocotyls (Krens and Jamar, 1989) and epicotyl-originated thin-layer explants (Toldi et al., 1996). The most efficient system of sugarbeet direct regeneration is shoot morphogenesis from petioles. However, the use of petioles for transformation leads to production of transformed compact, non-regenerable callus and untransformed shoots (D'Halluin et al., 1992a). Even using vacuum infiltration of sugarbeet petioles for Agrobacterium-mediated transformation, we could not produce transgenic shoots as well. Thereby direct shoot regeneration is unacceptable system for sugarbeet transformation, since both transformed and untransformed cells are able to proliferate under selective conditions and participate in shoot formation, even when high concentration of PPT (20 In this connection, we have used indirect regeneration system, namely shoot organogenesis from callus. Sugarbeet friable callus derived from hypocotyl and cotyledon has high regeneration capacity (Catlin, 1990, Jacq et al., 1992, Snyder et al., 1999, Dovzhenko and Koop, 2003), therefore friable callus and seedlings were used in this study as starting material for agrobacterial transformation. Thus using about 1 After genetic transformation of sugarbeet seedlings with A. tumefaciens GV3101 carrying pICBV19, friable callus have arisen from cotyledons and hypocotyls on selective medium MS15B2 supplemented with 10 Table 1. PPT-resistant sugarbeet callus clones and plants transformed with A. tumefaciens carrying pICBV19
Obtained callus clones were tested for GUS activity. Approximately 40% selected clones were positive for the β-glucuronidase (Table 1). Most of transgenic clones were GUS-negative, hypotetically it could be suggested about “gene silence” of gusA gene. Three regenerated plants for sugarbeet breeding line KS3 and six plants for KS7 were obtained on selective medium MSR supplemented with 10 
Fig. 1 Regeneration of transformed sugarbeet shoots from friable callus resistant to 10 The presence of the gusA and bar genes in selected callus clones and regenerated plants was confirmed by PCR analysis (Fig. 2). About 90% of analysed callus clones were transgenic, that indicates high efficiency of the selection strategy. 
Fig. 2 PCR detection of gusA (1–9) and bar (11–19) genes in transgenic sugarbeet plants. (1, 11 – plasmid DNA pICBV19; 2, 12 – master mix; 3–8, 13–18 – DNA of transformed sugarbeet plants; 9, 19 – DNA of untransformed initial plant; 10 – 1 An efficient Agrobacterium-mediated genetic transformation system for sugarbeet was developed. Obtained transgenic O-type sugarbeet plants resistant to phosphinothricin will cross with CMS inbred lines to produce hybrid progeny for subsequent testing for herbicide resistance. References Catlin DW. The effect of antibiotics on the inhibition of callus induction and plant regeneration from cotyledons of sugarbeet (Beta vulgaris L.). Plant Cell Rep 1990:9:285-8 Cheung WY, Hubert, N, Landry, BS. A simple and rapid DNA microextraction method for plant, animal and insect suitable for RAPD and other PCR analysis. PCR Meths Applics 1993:3:69-70 Detrez C, Tetu, T, Sagwan, RS, Sagwan-Norreel, BS. Direct organogenesis from petiole and thin cell layer explants in sugar beet cultured in vitro. J Exp Bot 1988:39:917-26 Detrez C, Sangwan, RS, Sangwan-Norreel, BS. Phenotypic and karyotypic status of Beta vulgaris plants regenerated from direct organogenesis in petiole culture. Theor Appl Genet 1989:77:462-8 D'Halluin K, Bossut, M, Bonne, E, Mazur, B, Leemans, J, Botterman, J. Transformation of sugarbeet (Beta vulgaris L.) and evaluation of herbicide resistance in transgenic plants. Bio/Technology 1992:10:309-14 D'Halluin K, De Block, M, Denecke, J, Janssen, J, Leeman, J, Raynaert, A. The bar gene as selectable and screenable marker in plant engineering. Methods Enzym 1992:216:415-26 Dovzhenko A, Koop, HU. Sugarbeet (Beta vulgaris L.): shoot regeneration from callus and callus protoplasts. Planta 2003:217:374-81 Freytag AH, Anand, SC, Rao-Arelli, AP, Owens, LD. An improved medium for adventitious shoot formation and callus induction in Beta vulgaris L. in vitro. Plant Cell Rep 1988:7:30-4 Hall RD, Riksen-Bruinsma, T, Weyens, GJ, Rosquin, IJ, Denis, PN, Evans, IJ. A high efficiency technique for the generation of transgenic sugar beets from stomatal guard cell. Nature Biotechnol 1996:14:1133-8 Hisano H, Kimoto, Y, Takeichi, J, Hashimito Abe, J, Asano, S, Kanasavwa, A. High frequency Agrobacterium-mediated transformation and plant regeneration via direct shoot formation from leaf explants in Beta vulgaris and Beta maritima. Plant Cell Rep 2004:22:910-8 Jacq B, Tetu, T, Sangwan, RS, Laat, AD, Sangwan-Norreel, BS. Plant regeneration from sugarbeet (Beta vulgaris L.) hypocotyls cultured in vitro and flow cytometric nuclear DNA analysis of regenerants. Plant Cell Rep 1992:11:329-33 Joersbo M, Petersen, SG, Okkels, FT. Parameters interacting with mannose selection employed for the production of transgenic sugar beet. Physiol Plant 1999:105:109-15 Kapila J, De Rycke, R, Van Montagu, M, Angenon, G. An Agrobacterium-mediated transient gene expression system for intact leaves. Plant Sci 1997:122:101-8 Krens FA, Zijlstra, C, Molen, W, Jamar, D, Huizing, HJ. Transformation and regeneration in sugarbeet (Beta vulgaris L.) induced by “shooter” mutants of Agrobacterium tumefaciens. Euphitica 1988:5:185-94 Krens FA, Jamar, D. The role of explant source and culture conditions on callus induction and shoot regeneration in sugarbeet (Beta vulgaris L.). J Plant Physiol 1989:134:651-5 Krens FA, Trifonova, A, Keizer, LCP, Hall, RD. The effect of exogenously-applied phytohormones on gene transfer efficiency in sugarbeet (Beta vulgaris L.). Plant Sci 1996:116:97-106 Lindsey K, Gallois, P. Transformation of sugarbeet (Beta vulgaris) by Agrobacterim tumefaciens. J Exp Bot 1990:41:529-36 Morel G, Wetmore, RH. Fern callus tissue culture. Am J Bot 1951:38:141-3 Murashige T, Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 1962:15:473-97 Paul H, Zijstra, C, Leeuwangh, JE, Krens, FA, Huizing, HJ. Reproduction of the beet cyst nematode Heterodera schachtii Schm. on transformed root cultures of Beta vulgaris L. Plant Cell Rep 1987:6:379-81 Sambrook J, Fritsch, EF, Maniatis, T. Molecular cloning: a laboratory manual. 1989: Saunders JW, Doley, WP. One step shoot regeneration from callus of whole plant leaf explants of sugarbeet lines and a somaclonal variant for in vitro behaviour. J Plant Physiol 1986:124:473-81 Snyder GW, Ingersoll, JC, Smigocki, AC, Owens, LD. Introduction of pathogen defence genes and a cytokinin biosynthesis gene into sugarbeet (Beta vulgaris L.) by Agrobacterium or particle bombardment. Plant Cell Rep 1999:18:829-34 Toldi O, Gyulai, G, Kiss, J, Tamas, IA, Balazs, E. Antiauxin enchanced microshoot initiation and plant regeneration from epicotyl-originated thin-layer explants of sugarbeet (Beta vulgaris L.). Plant Cell Rep 1996:15:851-4 Wozniak CA, Owens, LD. Native β-glucuronidase activity in sugarbeet (Beta vulgaris). Physiol Plant 1994:90:763-71 Received 1 July 2004/2 November 2004; accepted 11 November 2004 doi:10.1016/j.cellbi.2004.11.003 |
ISSN Print: 1065-6995
ISSN Electronic: 1095-8355 Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB) |
Abstract