Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2005) 29, 15–19 (Printed in Great Britain)
Production of transgenetic sugarbeet (Beta vulgaris L.) plants resistant to phosphinothricin
E.M. Kishchenko*, I.K. Komarnitskii and N.V. Kuchuk
Institute of Cell Biology & Genetic Engineering Natl. Acad. Sci. of Ukraine, 148 Zabolotnogo Str., Kyiv 03143, Ukraine


Abstract

A method of Agrobacterium-mediated genetic transformation of sugarbeet (Beta vulgaris L.) with vacuum infiltration has been developed. Aseptic 3-weeks old etiolated seedlings of two diploid O-type sugarbeet lines (KS3 and KS7) have been used for genetic transformation. Transgenic sugarbeet plants carrying the reporter β-glucuronidase gene have been selected for their resistance to glufosinate ammonium herbicide. Integration of transgenes into sugarbeet genome was confirmed with GUS assay and PCR using primers for bar and gusA genes.


Keywords: Beta vulgaris L., Sugarbeet, Regeneration, Transformation, Agrobacterium tumefaciens.

*Corresponding author.


1 Introduction

Sugarbeet (Beta vulgaris L.) is a commercially important sucrose-producing crop particularly in temperate zones. The availability of transgenic herbicide resistant sugarbeet would improve weed control and increase profitability of this culture. Despite considerable progress has been made during last decade for introduction of foreign genes into crops sugarbeet still remains recalcitrant for genetic transformation. There are several reports on Agrobacterium tumefaciens-mediated transformation (Lindsey and Gallois, 1990; D'Halluin et al., 1992a,b; Krens et al., 1996, Snyder et al., 1999, Hisano et al., 2004), particle bombardment method (Snyder et al., 1999) and only one publication concerning protoplast-based transformation system of sugarbeet (Hall et al., 1996).

The present work describes Agrobacterium-mediated genetic transformation system for O-type diploid sugarbeet lines used to maintain cytoplasmic male sterile (CMS) lines involved into hybrid breeding. We have used developed protocol to obtain transgenic sugarbeet plants resistant to glufosinate ammonium herbicide (phosphinothricin, PPT). Phosphinothricin is irreversible inhibitor of glutamine synthase, which plays a central role in assimilation of ammonia and in regulation of nitrogen metabolism in plants. Application of PPT leads to several immediate metabolic dysfunctions and plant death. bar gene encodes phosphinothricin acetyl transferase (PAT), that inactivates the herbicide by acetylation. Stable introduction of bar gene into crop genome has yielded plant resistant to this herbicide. Transgenic herbicide resistant sugarbeet plants were analysed by ensymatic assay and molecular analysis.

2 Materials and methods

2.1 Agrobacterium strain and plasmids

A. tumefaciens nopaline strain GV3101 harboring the binary vector pICBV19 was used. T-DNA region pICBV19 contains phosphinothricin acetyl transferase gene (bar) with nopaline synthase (nos) promoter and octopine synthase (ocs) terminator and β-glucuronidase gene (gusA) with CaMV35S promoter and nopaline synthase terminator. Binary vector pICBV19 was provided by Icon Genetics GmbH (Halle, FRG). The bacteria were grown in LB medium (Sambrook et al., 1989) containing 50mg/l rifampicin and 50mg/l carbenicillin for 48h at 28°C on rotary shaker (200 r.p.m.) and then used for genetic transformation.

2.2 Plant material

Two diploid O-type sugarbeet lines (B. vulgaris L.) were used: KS3 and KS7. Seeds were kindly provided by Prof. F.M. Parij (Institute of Sugarbeet, Kiev, Ukraine).

Sugarbeet seeds were incubated at +4°C for a week then soaked in water at the room temperature overnight prior to surface sterilization. Seeds were sterilized in 40% (v/v) formalin for 2min, transferred to 70% ethanol for 30s, treated with 30% (v/v) bleach (1.5% sodium hypochlorite) for 20min and washed in autoclaved distilled water 3 times for 10min. Seeds were germinated on MS medium (Murashige and Skoog, 1962) containing 15g/l sucrose and 2mg/l BA (MS15B2) at 22°C in the dark.

Friable callus was induced from hypocotyl and cotyledon explants on MS15B2 medium in the dark. Callus was cultured in the liquid MS medium by adding 2mg/l ascorbic acid and plant growth regulators 0.3mg/l BA and 0.1mg/l NAA to produce suspension culture. Cells of suspension culture were harvested and used for genetic transformation.

2.3 Transformation and regeneration

Suspension cell culture and aseptic 3-weeks old etiolated seedlings were utilized as starting material for genetic transformation of sugarbeet.

Two-day agrobacterial culture was centrifuged at 4000g and resuspended with equal volume of solution containing 440mg/l CaCl2×2H2O, 1650mg/l NH4NO3, 170mg/l KH2PO4, 1900mg/l KNO3, 370mg/l MgSO4×7H2O, 20g/l sucrose, 2g/l glucose, 2mg/l BA and 0.2mM acetosyringone. Obtained bacterial suspension was cultivated for 2h on rotary shaker (200 r.p.m.), and used for vacuum infiltration (Kapila et al., 1997) of sugarbeet cells. After vacuum infiltration agrobacteria were removed and sugarbeet cells were incubated for 3 days in the dark. Then they were washed with autoclaved distilled water and cultivated in the liquid MS medium containing 2mg/l ascorbic acid, 0.3mg/l BA, 0.1mg/l NAA, 600mg/l cefotaxime and 5mg/l PPT. After week, cells were harvested and transferred to solid MSR medium for regeneration supplemented with 300mg/l cefotaxime and 10mg/l PPT at 24°C under scattered light and 16-h photoperiod. MSR medium composed of MS basal salts, Morel vitamins (Morel and Wetmore, 1951), 30g/l sucrose, 29mM silver thiosulfate, 0.5g/l polyvinylpirrolidone, 1mg/l BA, 0.3mg/l IAA and 0.4mg/l GA3.

Aseptic etiolated seedlings of sugarbeet were used for Agrobacterium-mediated transformation in the same way as cells of suspension culture. After vacuum infiltration, seedlings were transferred to sterile filter paper and incubated in the dark at 22–24°C for 3 days. Then seedlings were cut into 7–10mm pieces, incised and placed on MS15B2 medium supplemented with 500mg/l cefotaxime and 10mg/l PPT at 28°C in the dark. Within 6–8 weeks friable callus have arisen from cotyledons and hypocotyls. PPT resistant callus was isolated and further cultivated for regeneration on MSR medium supplemented with 300mg/l cefotaxime and 10mg/l PPT at 24°C under scattered light and 16-h photoperiod. Subcultivation period was about 3 weeks. Shoot regeneration occurred within 4–10 weeks. Selected shoots were transferred to MS medium supplemented with 0.5mg/l IBA, 100mg/l cefotaxime and 10mg/l PPT for rooting.

2.4 GUS assay

β-Glucuronidase activity in transformed plant tissues was detected as described by Wozniak and Owens (1994) with modification proposed by Krens et al. (1996). Tissues were stained for 12h at 37°C in 0.1M phosphate buffer pH 7.0 containing 1mM X-Gluc, 10mM EDTA, 2.5mM K4[Fe(CN)6], 2.5mM K3[Fe(CN)6], 2mM dithiotreitol, 0.1% (v/v) Triton X-100 and 20% (v/v) methanol. After staining, chlorophyll from green tissues was removed by washing in 70% (v/v) ethanol.

2.5 PCR analysis

Total plant DNA for polymerase chain reaction (PCR) was extracted as described by Cheung et al. (1993). Sequences 5′GGCCCCAATCCAGTCCATTAATGCG and 3′TGGGTGGACGATATCACCGTGGTGA were used for gus gene amplification. The probes amplified 423-bp fragment. For bar genes the use of primers 5′ATGAGCCCAGAACGACGCCCGGCC and 3′GCATGCGCACGGTCGGGTCGTTGG, resulted in a 414-bp amplificate. Cycling was carried out according to the following conditions: denaturation at 94°C for 1min, annealing at 65°C for bar gene and 56°C for gusA gene (1min), extension at 72°C (0.5min). Samples were subjected to 30 cycles. Amplification products were analysed by electroforesis on 1% agarose gel and detected with ethidium bromide staining.

3 Results and discussion

Routine transformation system of plants requires cell cultures competent for efficient plant regeneration as well as an effective method of gene delivery. A. tumefaciens remains the preferred tool in genetic transformation of plants. The advantageous features of Agrobacterium-mediated transformation include transfer of relatively large segments of DNA with defined ends and with minimal rearrangement, integration of small numbers of gene copies into plant chromosomes, and high quality and fertility of resultant transgenic plants. Although sugarbeet is susceptible to Agrobacterium infection (Paul et al., 1987; Krens et al., 1988) efficiency of further regeneration is low and genotype dependent. Moreover shoots regenerated from deeply buried cells, which are inaccessible for agrobacteria (D'Halluin et al., 1992a). In this connection, we have used the vacuum infiltration of plant tissues for delivery of agrobacteria (Kapila et al., 1997).

A well-defined, preferably simple shoot regeneration protocol is a prerequisite for production of transgenic plants. Direct organogenesis in sugarbeet is less genotype dependent (Detrez et al., 1989; Jacq et al., 1992; Toldi et al., 1996) than indirect regeneration and regenerated plants show more genetic stability (Detrez et al., 1989). Direct shoot regeneration was observed from various sugarbeet explants including petioles and leaves (Saunders and Doley, 1986; Detrez et al., 1988; Freytag et al., 1988; Krens and Jamar, 1989), shoot bases (Lindsey and Gallois, 1990, Hisano et al., 2004), cotyledons (Krens et al., 1996; Joersbo et al., 1999; Snyder et al., 1999), hypocotyls (Krens and Jamar, 1989) and epicotyl-originated thin-layer explants (Toldi et al., 1996). The most efficient system of sugarbeet direct regeneration is shoot morphogenesis from petioles. However, the use of petioles for transformation leads to production of transformed compact, non-regenerable callus and untransformed shoots (D'Halluin et al., 1992a). Even using vacuum infiltration of sugarbeet petioles for Agrobacterium-mediated transformation, we could not produce transgenic shoots as well. Thereby direct shoot regeneration is unacceptable system for sugarbeet transformation, since both transformed and untransformed cells are able to proliferate under selective conditions and participate in shoot formation, even when high concentration of PPT (20mg/l) was used.

In this connection, we have used indirect regeneration system, namely shoot organogenesis from callus. Sugarbeet friable callus derived from hypocotyl and cotyledon has high regeneration capacity (Catlin, 1990, Jacq et al., 1992, Snyder et al., 1999, Dovzhenko and Koop, 2003), therefore friable callus and seedlings were used in this study as starting material for agrobacterial transformation.

Thus using about 1g cells of sugarbeet suspension culture for transformation with A. tumefaciens GV3101 harbored pICBV19, we have obtained 50 callus clones resistant to 10mg/l PPT. Selected callus lines were tested for their β-glucuronidase activity. Almost all lines (90%) expressed GUS-activity. However, we failed to regenerate shoots from selected transgenic clones. Gene transfer into potentially regenerable cells did not result in recovery of transgenic plants as the capacity for efficient regeneration was short-lived. In order to reduce the stage of callus proliferation we used another approach. Etiolated seedlings were used in experiments for genetic transformation.

After genetic transformation of sugarbeet seedlings with A. tumefaciens GV3101 carrying pICBV19, friable callus have arisen from cotyledons and hypocotyls on selective medium MS15B2 supplemented with 10mg/l PPT. Phosphinothricin selection of plant tissues is much effective under light conditions (D'Halluin et al., 1992b). Incubation of sugarbeet explants in the dark is necessary for induction of regenerable callus that can reduce the sensitivity for PPT and a higher frequency of untransformed calli might be obtained. Exposure of selected callus to light increases the sensitivity to PPT leading to rapid cell death. The number of PPT-resistant callus clones was diminished under light conditions (Table 1).


Table 1.

PPT-resistant sugarbeet callus clones and plants transformed with A. tumefaciens carrying pICBV19

Breeding linesNumber of PPT-resistant callus clones selected in the darkNumber of PPT-resistant callus clones selected in the light% of transgenic callus clones (PCR analysis for gusA gene)% of GUS-positive callus clones (GUS assay)Number of PPT-resistant plants
КS3271690.937.53
КS7312285.745.56


Obtained callus clones were tested for GUS activity. Approximately 40% selected clones were positive for the β-glucuronidase (Table 1). Most of transgenic clones were GUS-negative, hypotetically it could be suggested about “gene silence” of gusA gene.

Three regenerated plants for sugarbeet breeding line KS3 and six plants for KS7 were obtained on selective medium MSR supplemented with 10mg/l PPT (Fig. 1). It is necessary to note that eight of nine initial regenerable callus clones had β-glucuronidase activity. Leaves from these regenerated plant were GUS-positive also.


Fig. 1

Regeneration of transformed sugarbeet shoots from friable callus resistant to 10mg/l PPT (scale bar=1cm).


The presence of the gusA and bar genes in selected callus clones and regenerated plants was confirmed by PCR analysis (Fig. 2). About 90% of analysed callus clones were transgenic, that indicates high efficiency of the selection strategy.


Fig. 2

PCR detection of gusA (1–9) and bar (11–19) genes in transgenic sugarbeet plants. (1, 11 – plasmid DNA pICBV19; 2, 12 – master mix; 3–8, 13–18 – DNA of transformed sugarbeet plants; 9, 19 – DNA of untransformed initial plant; 10 – 1kb Ladder (GibcoBRL).


An efficient Agrobacterium-mediated genetic transformation system for sugarbeet was developed. Obtained transgenic O-type sugarbeet plants resistant to phosphinothricin will cross with CMS inbred lines to produce hybrid progeny for subsequent testing for herbicide resistance.

References

Catlin DW. The effect of antibiotics on the inhibition of callus induction and plant regeneration from cotyledons of sugarbeet (Beta vulgaris L.). Plant Cell Rep 1990:9:285-8
1st Citation  

Cheung WY, Hubert, N, Landry, BS. A simple and rapid DNA microextraction method for plant, animal and insect suitable for RAPD and other PCR analysis. PCR Meths Applics 1993:3:69-70
1st Citation  

Detrez C, Tetu, T, Sagwan, RS, Sagwan-Norreel, BS. Direct organogenesis from petiole and thin cell layer explants in sugar beet cultured in vitro. J Exp Bot 1988:39:917-26
Crossref   1st Citation  

Detrez C, Sangwan, RS, Sangwan-Norreel, BS. Phenotypic and karyotypic status of Beta vulgaris plants regenerated from direct organogenesis in petiole culture. Theor Appl Genet 1989:77:462-8
1st Citation   2nd  

D'Halluin K, Bossut, M, Bonne, E, Mazur, B, Leemans, J, Botterman, J. Transformation of sugarbeet (Beta vulgaris L.) and evaluation of herbicide resistance in transgenic plants. Bio/Technology 1992:10:309-14
Crossref   1st Citation   2nd   3rd  

D'Halluin K, De Block, M, Denecke, J, Janssen, J, Leeman, J, Raynaert, A. The bar gene as selectable and screenable marker in plant engineering. Methods Enzym 1992:216:415-26
1st Citation   2nd  

Dovzhenko A, Koop, HU. Sugarbeet (Beta vulgaris L.): shoot regeneration from callus and callus protoplasts. Planta 2003:217:374-81
Crossref   Medline   1st Citation  

Freytag AH, Anand, SC, Rao-Arelli, AP, Owens, LD. An improved medium for adventitious shoot formation and callus induction in Beta vulgaris L. in vitro. Plant Cell Rep 1988:7:30-4
Crossref   1st Citation  

Hall RD, Riksen-Bruinsma, T, Weyens, GJ, Rosquin, IJ, Denis, PN, Evans, IJ. A high efficiency technique for the generation of transgenic sugar beets from stomatal guard cell. Nature Biotechnol 1996:14:1133-8
Crossref   1st Citation  

Hisano H, Kimoto, Y, Takeichi, J, Hashimito Abe, J, Asano, S, Kanasavwa, A. High frequency Agrobacterium-mediated transformation and plant regeneration via direct shoot formation from leaf explants in Beta vulgaris and Beta maritima. Plant Cell Rep 2004:22:910-8
Medline   1st Citation   2nd  

Jacq B, Tetu, T, Sangwan, RS, Laat, AD, Sangwan-Norreel, BS. Plant regeneration from sugarbeet (Beta vulgaris L.) hypocotyls cultured in vitro and flow cytometric nuclear DNA analysis of regenerants. Plant Cell Rep 1992:11:329-33
1st Citation   2nd  

Joersbo M, Petersen, SG, Okkels, FT. Parameters interacting with mannose selection employed for the production of transgenic sugar beet. Physiol Plant 1999:105:109-15
Crossref   1st Citation  

Kapila J, De Rycke, R, Van Montagu, M, Angenon, G. An Agrobacterium-mediated transient gene expression system for intact leaves. Plant Sci 1997:122:101-8
Crossref   1st Citation   2nd  

Krens FA, Zijlstra, C, Molen, W, Jamar, D, Huizing, HJ. Transformation and regeneration in sugarbeet (Beta vulgaris L.) induced by “shooter” mutants of Agrobacterium tumefaciens. Euphitica 1988:5:185-94
1st Citation  

Krens FA, Jamar, D. The role of explant source and culture conditions on callus induction and shoot regeneration in sugarbeet (Beta vulgaris L.). J Plant Physiol 1989:134:651-5
1st Citation   2nd  

Krens FA, Trifonova, A, Keizer, LCP, Hall, RD. The effect of exogenously-applied phytohormones on gene transfer efficiency in sugarbeet (Beta vulgaris L.). Plant Sci 1996:116:97-106
Crossref   1st Citation   2nd   3rd  

Lindsey K, Gallois, P. Transformation of sugarbeet (Beta vulgaris) by Agrobacterim tumefaciens. J Exp Bot 1990:41:529-36
Crossref   1st Citation   2nd  

Morel G, Wetmore, RH. Fern callus tissue culture. Am J Bot 1951:38:141-3
Crossref   1st Citation  

Murashige T, Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 1962:15:473-97
Crossref   1st Citation  

Paul H, Zijstra, C, Leeuwangh, JE, Krens, FA, Huizing, HJ. Reproduction of the beet cyst nematode Heterodera schachtii Schm. on transformed root cultures of Beta vulgaris L. Plant Cell Rep 1987:6:379-81
Crossref   1st Citation  

Sambrook J, Fritsch, EF, Maniatis, T. Molecular cloning: a laboratory manual. 1989:
1st Citation  

Saunders JW, Doley, WP. One step shoot regeneration from callus of whole plant leaf explants of sugarbeet lines and a somaclonal variant for in vitro behaviour. J Plant Physiol 1986:124:473-81
1st Citation  

Snyder GW, Ingersoll, JC, Smigocki, AC, Owens, LD. Introduction of pathogen defence genes and a cytokinin biosynthesis gene into sugarbeet (Beta vulgaris L.) by Agrobacterium or particle bombardment. Plant Cell Rep 1999:18:829-34
Crossref   1st Citation   2nd   3rd   4th  

Toldi O, Gyulai, G, Kiss, J, Tamas, IA, Balazs, E. Antiauxin enchanced microshoot initiation and plant regeneration from epicotyl-originated thin-layer explants of sugarbeet (Beta vulgaris L.). Plant Cell Rep 1996:15:851-4
Crossref   1st Citation   2nd  

Wozniak CA, Owens, LD. Native β-glucuronidase activity in sugarbeet (Beta vulgaris). Physiol Plant 1994:90:763-71
Crossref   1st Citation  


Received 1 July 2004/2 November 2004; accepted 11 November 2004

doi:10.1016/j.cellbi.2004.11.003


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)