Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2006) 30, 559–567 (Printed in Great Britain)
Cellular isoform of the prion protein PrPc in human intestinal cell lines: Genetic polymorphism at codon 129, mRNA quantification and protein detection in lipid rafts
Nicolas Garmya, Xiao‑Jun Guoab, Nadira Taïeba, Christian Tourrèsc, Catherine Tamaletc, Jacques Fantinia* and Nouara Yahia
aLaboratoire de Biochimie et Physicochimie des Membranes Biologiques, Faculté des Sciences de St-Jérôme, Université Paul Cézanne, Avenue Escadrille Normandie-Niemen, 13397 Marseille Cedex 20, France
bCentre d'Immunologie de Marseille-Luminy, 13009 Marseille, France
cLaboratoire de Virologie, CHRU de la Timone, 13005 Marseille, France


Abstract

The cellular isoform of the normal prion protein PrPc, encoded by the PRNP gene, is expressed in human intestinal epithelial cells where it may represent a potential target for infectious prions. We have sequenced the PRNP gene in Caco-2 and HT-29 parental and clonal cell lines, and found that these cells have a distinct polymorphism at codon 129. HT-29 cells are homozygous Met/Met, whereas Caco-2 cells are heterozygous Met/Val. The 129Val variant was also detected in Caco-2 mRNAs. Real-time PCR quantifications revealed that PrPc mRNAs were more expressed in HT-29 cells than in Caco-2 cells. These data were confirmed by studying the expression of PrPc in plasma membranes and lipid rafts prepared from these cells. Overall, these results may be important in view of using human intestinal cell lines Caco-2 and HT-29 as cellular in vitro models to study the initial steps of prion propagation after oral inoculation.


Keywords: Prion, Lipid raft, M129V polymorphism, Prominin, Intestinal, Real-time RT-PCR, DNA sequencing.

*Corresponding author. Tel.: +33 491 288 761; fax: +33 491 288 440.


1 Introduction

Prion diseases are fatal neurodegenerative disorders that include Creutzfeldt–Jakob disease (CJD), Gerstmann–Sträussler syndrome (GSS) and fatal familial insomnia (FFI) in humans, along with scrapie and bovine spongiform encephalopathy in animals (Prusiner, 1998). These neural diseases can have an infectious or genetic origin, or can arise spontaneously. The hallmark of prion diseases is the conversion of a normal, cell-surface associated glycoprotein designated PrPc to a pathogenic form denoted PrPsc (Prusiner, 1982, 1998). According to the prion paradigm, PrPc is considered as the normal cellular isoform of the prion protein, whereas PrPsc, the pathogenic form, is considered as the only infectious component of prion particles (Prusiner, 1998). PrPc is converted into the infectious agent through a profound conformational change. Circular dichroism studies have revealed that PrPc is mainly composed of α-helical conformation, whereas PrPsc is rich in β-sheet secondary structure (Pan et al., 1993).

This conformational change occurs after the formation of a complex between the infectious PrPsc protein and PrPc, so that the interaction between prion protein isoforms has been referred to as ‘the kiss of death’ (Caughey, 2001). The meeting of PrPc and PrPsc appears to occur in specific microdomains of the plasma membrane of target cells in which PrPc is preferentially located, i.e. lipid rafts (Vey et al., 1996). The insertion of PrPsc in the immediate vicinity of lipid rafts containing PrPc is considered as the initial phase of prion propagation at the cellular level (Baron et al., 2002). Accordingly, PrPc expression by target cells is a prerequisite for the occurrence and spread of prion diseases. This essential feature of prion biology has been demonstrated by the lack of prion infection in mice lacking the gene coding for PrPc (Büeler et al., 1993).

This gene, called PRNP, is located on the short arm of chromosome 20 in humans. The entire open reading frame (ORF) of the PRNP gene resides within a single exon (Prusiner, 1998). Mutations in the human PRNP gene are associated with the development of neurodegenerative diseases. For instance, the E200K mutation is linked to the most prevalent form of inherited CJD (Johnson and Gibbs, 1998). Moreover, a natural polymorphism at codon 129 of the human PRNP gene, resulting in either methionine or valine, has a profound influence on susceptibility and phenotypic expression of disease (Johnson and Gibbs, 1998).

The physiological function of PrPc is currently unknown, although the protein has been involved in various cellular processes, including copper binding (Thompsett et al., 2005) and signal transduction (Mouillet-Richard et al., 2000). PrPc is abundantly expressed in brain tissues but is also found in various extraneural tissues (Martins et al., 2002) including blood cells (Dodelet and Cashman, 1998). Since some forms of transmissible spongiform encephalopaties result from oral infection, the expression of PrPc has also been studied in the gastrointestinal tract (Pammer et al., 2000). Indeed, the accumulation of bovine PrPsc in Peyer's patches after oral infection in animal models strongly suggests that prions could cross the intestinal epithelium (Maignien et al., 1999; Beekes and McBride, 2000).

Interestingly, immunohistochemical studies have shown the presence of PrPc in epithelial cells of both the small and large bowels (Pammer et al., 2000). PrPc has also been detected in some human colon intestinal cell lines by either immunofluorescent or Western blotting techniques (Mishra et al., 2004; Morel et al., 2004; Pammer et al., 2000). Finally, it has been shown that bovine PrPsc is transported through intact human intestinal epithelial Caco-2 and HT-29 cells (Mishra et al., 2004). Altogether, these data are consistent with the view that the intestinal epithelium may represent a first target for PrPsc after oral inoculation. Nevertheless, several questions remain unsolved. In particular, the sequence of the PRNP gene in HT-29 and Caco-2 cells has not been determined, and expression levels of PrPc mRNA in these cells have not been studied.

Yet this information may be particularly important in view of using human intestinal cell lines as cellular in vitro models to study the initial steps of prion propagation after oral inoculation. In the present study, we have sequenced the PRNP gene in Caco-2 and HT-29 cell lines, as well as in clonal populations (Caco-2-Cl14 and HT-29-D4) derived from these cells. PRNP mRNAs have also been sequenced and their level of expression analyzed by real-time quantitative PCR. The presence of PrPc has been studied in plasma membrane preparations as well as in lipid raft fractions. Finally, we have studied the impact of the enterocytic differentiation process on the level of expression of PRNP mRNAs and PrPc proteins in HT-29-D4 cells. Our data demonstrated that Caco-2 and HT-29 cells differ in both the natural polymorphism of the PRNP gene at codon 129 and in the levels of expression of PRNP mRNAs and PrPc proteins.

2 Materials and methods

2.1 Materials

The monoclonal anti-PrPc antibodies used were 3F4 (Chemicon International) and 6H4 (Prionics). The anti-Rab-5 rabbit antiserum was provided by P. Chavrier (Institut Curie Recherche, Paris). Secondary antibodies were from Immunotech. PCR and RT-PCR primers were obtained from Eurogentec. Cholera toxin B subunit coupled with horseradish peroxidase was from Sigma.

2.2 Cell culture

Human intestinal cell lines Caco-2, Caco-2-Cl14, HT-29 and HT-29-D4 (Fantini et al., 1993) were routinely grown in 75-cm2 flasks (Corning) in DMEM/F12 medium supplemented with 10% foetal calf serum. To induce differentiation of HT-29-D4 cells, half-confluent cultures were grown in glucose-free DMEM supplemented with 5mM galactose and 10% dialyzed foetal calf serum for 16 days, as previously reported (Garmy et al., 2005a). Undifferentiated HT-29-D4 cells were referred to as HT-29-D4 Glc, whereas their differentiated counterparts were referred to as HT-29-D4 Gal.

2.3 DNA extraction, amplification and sequencing

Genomic DNA was extracted from cell pellets with the QIAamp tissue kit (Qiagen). DNA was amplified by PCR with Taq DNA polymerase and supplied buffer (Roche Diagnostics). PCR was performed with primers A and D: A-5′GCAGTCATTATGGCGAACC3′ and D-5′CCTTCCTCATCCCACTATC3′ (modified from Petraroli et al., 2000). The material was amplified with a model 2400 Thermal Cycler (Applied Biosystems) as follows: first denaturation of 10min at 96°C, then 30 cycles consisting in 30s denaturation at 94°C, 30s annealing at 60°C, and 45s extension at 72°C. The purified PCR products were sequenced bidirectionally with the ABI PRISM dye terminator cycle sequencing kit with AmpliTaq DNA polymerase FS (Applied Biosystems) and were analyzed with the Applied Biosystems 377 automatic sequencing system. The sequences were aligned on the human PRNP gene (Genbank accession number M13899) with Sequence Navigator software (Applied Biosystems).

2.4 RNA extraction, reverse transcription, amplification and sequencing

Total RNA was isolated from the indicated cells using Trizol (Invitrogen). Total RNA was then treated with RQ1 RNase free DNase (Promega) and re-extracted twice with phenol-chloroform. One-step RT-PCR of total RNA was then performed with primers A and D with the Superscript II (Invitrogen). 1μl of PCR products were amplified by nested PCR with Taq DNA polymerase as described above. The sequences of the primers used are as follows (Dodelet and Cashman, 1998): HPF-5′AAGCCTGGAGGATGGAACACT3′, HPR-5′GTTGCTGTACTCATCCATGGG3′.

The purified PCR products were sequenced bidirectionally with the ABI PRISM BigDye terminator cycle sequencing kit with AmpliTaq DNA polymerase FS (Applied Biosystems) and were analyzed with the Applied Biosystems 3100 automatic sequencing system.

2.5 Quantification of PrP and prominin mRNA using real-time quantitative RT-PCR

Total RNA was extracted from cells using the Trizol Reagent (Invitrogen) according to the manufacturer's protocol. DNase I-treated RNA was spectrophotometrically quantified (260nm) and purity was assessed by the A260/280nm ratio. Reverse transcription reaction was carried out with the high capacity cDNA archive kit (Applied Biosystems) in 100μl reaction buffer containing 1μg of total RNA following the manufacturer's instructions.

PCR primers and FAM dye-labeled Taqman MGB probes sets were obtained from the Applied Biosystems Assays-on-demand (for PRNP) and Assays-by-design (for prominin) product lines. These primers were specifically designed to detect and quantify cDNA sequences without detecting genomic DNA. The FAM (6-carboxy-fluorescein) was used as fluorescent reporter dye and conjugated to 5′ ends of probes to detect amplification products. The amount of FAM fluorescence in each reaction liberated by the exonuclease degradation of the TaqMan probe during PCR amplification was measured as a function of PCR cycle number using an ABI 7000 Prism (Applied Biosystems) (Garmy et al., 2005b). Oligonucleotide primers and probe for Glyceraldehyde-3-phosphate (GAPDH) were obtained from Applied Biosystems as a preoptimised mix.

PCR was carried out in 96-well plates on cDNA equivalent to 5ng of total RNA. Thermal cycling conditions were 2min at 50°C and 10min at 95°C followed with 40 cycles at 95°C for 15s and 60°C for 1min. Data were collected using the ABI PRISM 7000 SDS analytical thermal cycler (Applied Biosystems). Each sample was tested in triplicate to ensure statistical significance. The relative quantification of PrPc and prominin gene expression was performed using the comparative Ct method (Livak and Schmittgen, 2001). The Ct value is defined as the point where a statistically significant increase in the fluorescence has occurred. The number of PCR cycles (Ct) required for the FAM intensities to exceed a threshold just above background was calculated for the test and reference reactions. In all experiments, GAPDH was used as the endogenous control. Results were analyzed in a relative quantitation study with the Caco-2 cell line serving as the calibrator (sample used as the basis for comparative results). Negative controls were included in the reaction plate: (i) a minus reverse transcriptase control (mock reverse transcription with all the RT-PCR reagents except the reverse transcriptase) and (ii) a minus sample control containing all the RT-PCR reagents except the RNA template. No products were synthesized in those controls.

2.6 Rafts isolation

Cells were gently sonicated (five 5s bursts, 5W; Vibracell, Bioblock Scientific) in 1ml of ice-cold buffer A (25mM HEPES, 150mM NaCl, 1mM EGTA, 5mM NaVO4, 10mM NaP-P and 10mM NaF, 1μg/ml leupeptin, 1μg/ml pepstatin, 2μg/ml chymostatin and 5μg/ml α2 macroglobulin). The postnuclear supernatant (PNS) was obtained after centrifugation at 800g for 10min at 4°C. PNS from intestinal cells was pre-incubated for 4min at 37°C. Brij 98 (Sigma Chemical Co.) was then added to a final concentration of 1%. After 5min of solubilization at 37°C, the PNS (1ml) was diluted with 2ml of 37°C pre-warmed buffer A containing 2M sucrose (final sucrose concentration 1.33M; final Brij 98 concentration 0.33%) and chilled down on ice (55min) before being placed at the bottom of a step sucrose gradient (0.9–0.8–0.75–0.7–0.6–0.5–0.4–0.2M sucrose, 1ml each) in buffer A. Gradients were centrifuged at 38,000rpm for 16h in a SW41 rotor (Beckman Instruments Inc.) at 4°C. One milliliter fractions were harvested from the top, except for the last one (no. 9), which contained 3ml. Unless specified, the raft fraction corresponded to pooled fractions 2–5 and the non raft fraction to pooled fractions 8 and 9. GM1 in raft fractions was identified with peroxidase-coupled cholera toxin B subunit.

2.7 Plasma membrane preparation

The purification of the plasma membrane from whole intestinal cells was conducted by a two-phase separation method, using polyethyleneglycol (PEG) and dextran (Morré and Morré, 1989). The cells were incubated in a hypotonic buffer (10mM Tris–HCl, 0.5mM MgCl2, 1μg/ml leupeptin, 1μg/ml pepstatin, 2μg/ml chymostatin and 5μg/ml α2 macroglobulin) for 30min at 4°C. The cells were then broken by Potter homogenization, centrifuged at 500g (5min at 4°C) and the supernatant was collected. This step was repeated five times. The supernatants were pooled and ultracentrifuged for 1h at 80,000×g in a Beckman Ti 70 tube. The pellet, which contained the whole cellular membranes, was resuspended in 1ml of Na2CO3 1mM, layered onto a 6.6% (w/w) Dextran/PEG gradient and centrifuged for 10min at 1000rpm. This step was repeated twice. Plasma membranes were recovered in the PEG phase with 250μl of Na2CO3 1mM.

2.8 Statistical analysis

Unless stated otherwise, all experiments were conducted in triplicate and the results expressed as means±SD. ANOVA and the Fisher multiple-comparison post-hoc test were conducted. Differences with P<0.05 were considered significant.

3 Results

3.1 Sequencing of the coding region of the PRNP gene

Genomic DNA was extracted from Caco-2 and HT-29 cell lines as well as human PBMC. As shown in Fig. 1, a unique 777bp fragment was amplified in all cell lines tested, including human PBMC used as positive control for the amplification reaction of PRNP. This fragment contained the totality of the PRNP ORF gene (Petraroli et al., 2000). Direct sequencing of the PCR product was performed using the dye terminator technique. For HT-29, HT-29-D4 and PBMC, the sequences were identical to the reference sequence of the human PRNP gene. For Caco-2 and Cao-2-Cl14 cells, a single nucleotide change was detected, namely a G instead of an A at position 385 of the DNA sequence. This nucleotide belongs to the polymorphic codon 129, which is represented with either an ATG (Met) or a GTG (Val) sequence. Thus, these data indicate that Caco-2 and HT-29 cell lines have a distinct polymorphism at codon 129. The sequencing was performed several times in order to identify a possible heterozygosity of codon 129. This was clearly the case for Caco-2 cells, as both ATG and GTG could be detected in distinct sequences (Fig. 2A and B). Careful analysis of the electrophoregrams also revealed the presence of both ATG and GTG as a double A/G peak in the same sequence (Fig. 2C). In contrast, the ATG codon 129 in HT-29 and HT-29-D4 cells was always homozygous (Fig. 2D).


Fig. 1

Gel electrophoresis of PCR products. A single PCR product of 777bp was obtained after amplification of the PRNP gene from genomic DNA extracted from the following cells: (1) Caco-2-Cl14, (2) HT-29-D4, (3) Caco-2, and (4) PBMC. Negative PCR control (5) and DNA markers (6) are also shown. The DNA products were separated on a 2% agarose gel electrophoresis. The quality of these PCR products is compatible with their direct use in sequencing.


Fig. 2

Electrophoregrams of sequencing gel showing the sequence at codon 129. The electrophoregrams shown correspond to the sequence of PCR (left column) or RT-PCR products (right column) obtained after amplification of either genomic DNA or mRNA respectively. Nucleotides are numbered from the first base of the PRNP ORF. DNA: Caco-2 (A,B,C); HT-29 (D). RNA: Caco-2 (E); Caco-2-Cl14 (F); HT-29-D4 (G); HT-29 (H).



Then we analyzed the sequences of PRNP mRNAs expressed in intestinal cell lines. Following amplification of total RNA in a one-step RT-PCR, target cDNA products were sequenced with the BigDye terminator direct sequencing technique. In HT-29 and HT-29-D4 cells, the sequence at codon 129 was always ATG (Fig. 2G and H). In Caco-2 and Caco-2-Cl14 cells, codon 129 was always GTG (Fig. 2E and F), and the ATG sequence was not observed.

Overall, these data mean that the main PRNP mRNAs expressed by Caco-2 and HT-29 cells differ by their polymorphism at codon 129: GTG (Val) for Caco-2 and ATG (Met) for HT-29.

3.2 Quantification of PRNP mRNAs in intestinal cell lines

Real-time quantitative PCR was used to measure the levels of mRNA coding for PrPc. For the sake of comparison, we studied the expression of prominin, a membrane protein also localized in lipid rafts of the plasma membrane (Corbeil et al., 2001). The data were presented as the fold change (2ΔΔCt) in gene expression normalized to an endogenous reference gene (GAPDH) and relative to a calibrator (the Caco-2 cell line). For this calibrator, ΔΔCt equals zero, so that equals 1. PrP mRNA expression was more abundant in HT-29-D4 cells compared to Caco-2 cells (Table 1), whereas opposite results were obtained for prominin mRNA expression (Table 2). Namely, PrP mRNA was 1.79 times more expressed in HT-29-D4 cells than in Caco-2 cells. Similar results were obtained with HT-29 cells (data not shown). An interesting feature of the clonal HT-29-D4 cell line is that its differentiation phenotype can be easily modulated according to the culture conditions (Garmy et al., 2005a). In presence of glucose (Glc), the differentiation process is constitutively inhibited. The enterocytic differentiation process occurs when glucose is replaced with galactose (Gal). So, we could compare the level of expression of PrPc mRNAs in undifferentiated and differentiated HT-29-D4 cells. We found that the enterocytic differentiation of these cells was associated with a marked increase (3.26 fold) in the expression of PrPc mRNA (Table 1).


Table 1.

Relative quantification of PrP mRNA in intestinal cell lines


Table 2.

Relative quantification of prominin mRNA in intestinal cell lines

SampleTarget prominin CtEndogenous control GAPDH CtΔCt, prominin-GAPDH−ΔΔCt, −(ΔCtProm−ΔCtCaco-2)2−ΔΔCt prominin relative to Caco-2
Caco-2 (calibrator)26.051 ± 0.01022.318 ± 0.0173.733 ± 0.0190.000 ± 0.0191.00 (0.98–1.01)
HT-29-D4 Glc31.609 ± 0.08822.348 ± 0.0379.261 ± 0.095−5.528 ± 0.0950.021 (0.020–0.023)
HT-29-D4 Gal28.941 ± 0.03022.578 ± 0.2116.363 ± 0.213−2.630 ± 0.2130.16 (0.14–0.19)


SampleTarget PrP CtEndogenous control GAPDH CtΔCta PrP–GAPDH−ΔΔCtb, −(ΔCtPrP−ΔCtCaco-2)2−ΔΔCt c PrP relative to Caco-2
Caco-2 (calibrator)28.774 ± 0.05022.318 ± 0.0176.456 ± 0.0520.000 ± 0.0521.00 (0.96–1.03)
HT-29-D4 Glc27.964 ± 0.06022.348 ± 0.0375.616 ± 0.0700.84 ± 0.0701.79 (1.70–1.87)
HT-29-D4 Gal26.487 ± 0.07922.578 ± 0.2113.909 ± 0.2252.547 ± 0.2255.84 (5.00–6.83)
a ΔCt=target CtGAPDH Ct.
b −ΔΔCt=Ct targetΔCt calibrator). In these experiments, Caco-2 is used as internal calibrator. The calibrator is the 1× sample and all other quantities are expressed as an n-fold difference relative to the calibrator.
c The range given for PrP (or prominin in Table 2) relative to Caco-2 is determined by evaluating the expression: 2ΔΔCt with ΔΔCt+s and ΔΔCts, where s is the standard deviation of the ΔΔCt value.

In marked contrast with these data, prominin mRNAs were 48 times more expressed in Caco-2 cells than in HT-29-D4 cells (Table 2). Moreover, the enterocytic differentiation of HT-29-D4 cells was associated with a significant decrease (7.61 fold) of prominin mRNA abundance.

3.3 Detection of PrPc in lipid rafts

The higher expression of PrPc mRNAs in HT-29 vs. Caco-2 cells suggested that a similar pattern of expression could exist at the protein level. Moreover, the sequence data indicated that the protein encoded by these mRNAs differed at codon 129, with a Met for HT-29 cells and a Val for Caco-2 cells. As little is known about the cellular localization of the Met129Val variant of PrPc, we decided to search for the presence of PrPc in lipid rafts purified from HT-29 and Caco-2 cells. Lipid rafts were prepared at 37°C (Drevot et al., 2002) in order to avoid any possible rearrangements of membrane domains induced by a decrease in the temperature. PrPc was detected by immunoblotting with two monoclonal antibodies: 3F4, which recognizes residues 109–112, and 6H4, which recognizes residues 144–152. In lipid rafts prepared from Caco-2 cells, the 6H4 and 3F4 antibodies recognized a main band of 31kDa (Fig. 3A, lane 1; Fig. 3B, lane 1). This band was not detected in non-raft fractions (Fig. 3, lane 4).


Fig. 3

Association of PrPc with raft microdomains extracted from intestinal cell lines. Raft and non-raft fractions were separated by polyacrylamide gel electrophoresis (SDS-PAGE) without β-mercaptoethanol and electrotransferred onto the blotting membrane. The immunoblot analysis was performed with the anti-PrPc monoclonal antibodies 6H4 (panel A) or 3F4 (panel B). Rab-5 (a non-raft marker) and GM1 staining were also performed, as control for the quality of raft isolation. The following cell lines were analyzed: Caco-2 (lanes 1, 4), HT-29-D4 Gal (lanes 2, 5) and HT-29-D4 Glc (lanes 3, 6).


The quality of the preparation was assessed by probing the immunoblot membrane with an antibody against Rab5, a membrane protein which is excluded from lipid rafts (Melkonian et al., 1999). The presence of ganglioside GM1, a typical raft marker, confirmed the good quality of the raft fractions (Fig. 3A). As the same amount of proteins were loaded in each electrophoresis well, these data showed that GM1-positive lipid raft fractions were about twice as abundant in HT-29-D4 cells than in Caco-2 cells. The data also showed that PrPc was particularly enriched in lipid rafts prepared from HT-29-D4 cells compared to Caco-2 cells (Fig. 3A, lanes 1–3).

A semi-quantitative evaluation of the PrPc/GM1 ratio allowed estimation of the relative enrichment of PrPc in raft fractions from HT-29-D4 cells compared with Caco-2 cells (relative enrichment of 3.7). As expected, the non-raft fraction of intestinal cells contained low levels of PrPc (Fig. 3A, lanes 5 and 6). With the 3F4 antibody, the signal consisted of three bands of 27, 31 and 35kDa (Fig. 3B, lanes 2 and 3). With the 6H4 antibody, a larger band in the 31–40kDa region was detected (Fig. 3A, lanes 2 and 3). Finally, the intensity of the band was greater in differentiated HT-29-D4 cells than in undifferentiated cells, in full agreement with the quantification of PrPc mRNAs (compare lanes 2 and 3 in Fig. 3A and B).

To ensure that intestinal cells express PrPc in lipid rafts belonging to the plasma membrane, we searched for the presence of PrPc in a purified preparation of plasma membrane proteins from Caco-2 (Fig. 4, lane 1) or HT-29-D4 cells (Fig. 4, lane 2). The 6H4 antibody was used for probing PrPc, and the anti-Rab5 for endogenous control and calibrator. The data demonstrated that PrPc was actually expressed in the plasma membrane of both Caco-2 and HT-29-D4 cells.


Fig. 4

Expression of PrPc in plasma membranes prepared from intestinal cell lines. 1: Caco; 2: HT-29 D4Gal. Proteins in plasma membrane fractions were concentrated as described in Section 2, and submitted to SDS-PAGE without β-mercaptoethanol and immunoblot analysis. PrPc was stained by 6H4 monoclonal anti-PrPc andibody. Rab-5 staining was also performed, as a control for protein loading for each cell line.


4 Discussion

To the best of our knowledge, the expression of PrPc by human intestinal epithelial cells was reported for the first time by Pammer et al. (2000). In this publication, the authors studied the presence and distribution of PrPc in the mucosa of the gastrointestinal tract using immunohistochemistry. They found that PrPc was expressed in both the duodenal and ileal epithelium, and also in epithelial cells of the large bowel. Expression of PrPc in the intestinal epithelium was later confirmed by Morel et al. (2004) who found that the protein was concentrated in the lateral membranes of enterocytes, beneath the tight junctions. The data obtained with human epithelial intestinal cell lines appeared more conflicting. Immunoblot experiments with the anti-PrPc antibodies 3F4 and 6H4 revealed the presence of PrPc in HT-29 cells, but not in Caco-2 cells (Pammer et al., 2000). In a subsequent study, weak expression of PrPc was shown by immunoblotting with 3F4, and the level of expression was increased by 2.5-fold following transfection with a plasmid encoding human PrPc (Mishra et al., 2004). Finally, the presence of PrPc in the Caco2/TC7 clonal cell line was shown with the monoclonal anti-PrPc antibody 12F10, which recognizes residues 142–160 (Morel et al., 2005). Overall, these data suggest that the level of expression of PrPc is low in Caco-2 cells, and high in HT-29 cells. The weak expression of PrPc in Caco-2 cells may render the detection of the protein in cellular extracts difficult or, in some instances, impossible (Pammer et al., 2000).

We have studied the expression of PrPc in two distinct plasma membrane preparations obtained from Caco-2 and HT-29 parental or clonal cells. After concentration and immunoblotting of plasma membrane proteins, PrPc was unambiguously detected in both Caco-2 and HT-29-D4 cells with the 6H4 antibody (Fig. 4). PrPc was also detected in lipid raft fractions prepared from Caco-2 and HT-29-D4 cells with both the 6H4 and 3F4 antibodies, but in this case the signal observed for Caco-2 cells was very weak compared with HT-29-D4 cells (Fig. 3). Moreover, in the case of HT-29-D4 cells, the intensity of the PrPc band was increased for differentiated cells compared with undifferentiated cells. Such an effect of cellular differentiation on the level of PrPc expression has never been reported for intestinal cells. Interestingly, it has been shown that the level of PrPc expression on the surface of human T-lymphocytes is up-regulated as a consequence of cellular activation (Li et al., 2001). This could be due to a modification of chromatin conformation, as recently suggested (Lucia et al., 2002). Indeed, trichostatin A, an inhibitor of histone deacetylase, increased the activity of the PrPc promoter, resulting in higher levels of both PrPc mRNA and proteins.

A similar chromatin-dependent mechanism could be involved in HT-29-D4 cells, explaining the activation of PrPc expression in differentiated cells. An up-regulation of PrPc mRNA transcripts has been observed following nerve growth factor treatment in vivo (Mobley et al., 1988) and in vitro in PC12 cells (Lazarini et al., 1994). Yet, in this case real-time quantitative RT-PCR studies of PrPc mRNAs failed to confirm the effect of nerve growth factor (Mouillet-Richard et al., 1999). In the present study, the quantification of PrPc mRNAs by real-time RT-PCR was in line with the increased expression of PrPc in lipid rafts prepared from differentiated vs. undifferentiated HT-29-D4 cells. This finding is important, as the expression of PrPc in the plasma membrane of differentiated enterocytes may be relevant to the transepithelial transport of infectious prions and/or the susceptibility of enterocytes to prion infection.

We were also able to demonstrate that Caco-2 cells express around half as much (1.76-fold) PrPc mRNAs than HT-29 or HT-29-D4 cells. In agreement with our data, Mishra et al. (2004) stated that HT-29 cells “express twofold more PrPc than Caco-2”, based on the densitometric analysis of immunoblot data. The convergence between this study and our own data is remarkable, since the intensity of the signals on immunoblot membranes may not give an accurate quantitative estimation of a protein. Indeed, our real-time RT-PCR data have been normalized with an endogenous control, GAPDH. Moreover, we have included in the study an irrelevant gene encoding for prominin, a membrane protein found in lipid rafts of the plasma membrane. The results obtained with prominin were opposite to those obtained with PRNP (higher expression in Caco-2 vs. HT-29), so that we could rule out any artefactual effect caused by lower levels of Caco-2 mRNAs during the RT-PCR reaction.

A major outcome of the present study is that Caco-2 and HT-29 cells differ by the polymorphism of the PRNP gene at codon 129. A large body of evidence indicates that this polymorphism, alone or in conjunction with mutations in the PRNP gene modulates disease susceptibility and phenotypic expression of spongiform encephalopathies (Johnson and Gibbs, 1998). Indeed, in the mutation at codon 178 of PrPc, which is associated with familial forms of disease, the Met129 allele segregates with FFI and the Val129 allele with CJD. In some populations in the Middle East with the Glu200Lys mutation coupled with the Met-129 allele, the incidence of CJD is 100 times higher than the worldwide incidence (50 per million as opposed to 0.5 per million) (Kong et al., 2004). It has been estimated that 43% of the normal Caucasian population is Met-homozygous, 8% Val-homozygous, and 49% Met/Val heterozygous (Johnson and Gibbs, 1998). The established cell lines cultured in vitro may reflect this polymorphism.

From a biochemical point of view, the presence of a Met or a Val residue at position 129 of the PrPc amino acid sequence is all but anecdotal. Circular dichroism studies have been conducted with synthetic peptides corresponding to this region. It appeared that the Met-containing peptide has a greater propensity to adopt a β-sheet conformation (Petchanikow et al., 2001). This higher β-sheet tendency was associated with an increased ability to aggregate into amyloid-like fibrils. Correspondingly, Met-homozygous individuals represent 60%, 78%, and 100% of patients affected by the iatrogenic, sporadic, and new variant of CJD (vCJD), respectively (Johnson and Gibbs, 1998). However, one should also mention that two recent cases of vCJD have been detected in heterozygous Met/Val individuals (Peden et al., 2004; Belay, 2005). Nevertheless, these results suggest that the polymorphism at position 129 may have a major impact on the conformational flexibility of PrPc.

It could be noted that although both alleles were detected in genomic DNA from Caco-2 cells, only the mRNAs coding for the 129Val allele were detected by sequencing (Fig. 2). As a matter of fact, the use of fluorescent dye terminator cycle sequencing is a powerful technique that allows the detection of mixed populations by careful examination of the electrophoregrams (Yahi et al., 1999). This technology has been found to be superior to previous methods based on hybridization or restriction enzymes for the detection of point mutations in the PRNP gene (Petraroli et al., 2000). However, if the sequencing is performed only once, only one allele may be detected. Therefore, to detect the heterozygosity of codon 129, the sequencing of genomic DNA was performed several times. As expected, in the case of Caco-2 cells, both ATG (Met) and GTG (Val) were detected in distinct sequencing experiments (Fig. 2). A mixed population ATG/GTG was also seen. In mRNAs, the GTG codon was repeatedly detected. The threshold level of detection of a variant sequence in heterogenous populations has been estimated to be 10% of the whole sequence (Leitner et al., 1993). Therefore, the reproducible detection of 129Val mRNAs may suggest that if 129Met mRNAs are expressed by Caco-2 cells, they represent a minor population in comparison with 129Val mRNAs. In conclusion, these data show that the 129Val variant is actually expressed by Caco-2 cells, whereas HT-29 cells express the 129Met allele.

The reproducible detection of PrPc in the plasma membrane of Caco-2 cells (Fig. 4) suggests that the polymorphism at codon 129 does not impair the sorting of PrPc to this cellular compartment. Yet, one cannot rule out the possibility that the surface expression and/or specific targeting of the 129Val variant to lipid rafts could be decreased compared to the Met129 variant, as shown for several mutant PrPc in cellular models (Kong et al., 2004). Further studies will help to clarify this point. In any case, these data suggest that the Caco-2 cell line may not be a good model to study the infection of the intestinal epithelium with bovine PrPsc. Indeed, most patients suffering from the new-variant CJD are Met/Met homozygous. This is in line with the notion that the 129Met isoform appears to be required for the generation of infectious prions (Wadsworth et al., 2004). Thus, HT-29 cells, which constitutively express high levels of the Met129 PrPc, may be particularly sensitive to bovine PrPsc. Further studies will indicate whether PrPsc can persistently infect these cells.

Human epithelial intestinal cell lines have also been used as in vitro models to study the initial interaction of PrPsc with the intestinal epithelium during the course of oral prion infections (Mishra et al., 2004; Morel et al., 2005). According to the most recent findings, the receptor of infectious PrPsc on the apical plasma membrane of Caco-2/TC7 cells has been identified as the 37kDa/67kDa laminin receptor (Morel et al., 2005). We do not question the potential role of this receptor in the endocytosis of PrPsc by Caco-2 cells, and we are aware that clonal cell lines may significantly differ from parental cells. Nevertheless, two important cellular factors known to bind to PrPsc are weakly expressed by Caco-2 cells: PrPc (Pammer et al., 2000; this study) and galactosylceramide (GalCer) (Fantini et al., 1993), a raft lipid co-purified with infectious prion rods (Klein et al., 1998). In contrast, these two molecules have a significantly higher expression in HT-29 cells than in Caco-2 cells. Therefore, it should be particularly legitimate to investigate the role of the laminin receptor as a potential PrPsc receptor in intestinal cells expressing high levels of both PrPc and GalCer, e.g. HT-29 cells or clonal derivatives.

References

Baron GS, Wehrly, K, Dorward, DW, Chesebro, B, Caughey, B. Conversion of raft associated prion protein to the protease-resistant state requires insertion of PrP-res (PrP(Sc)) into contiguous membranes. EMBO J 2002:21:1031-40
Crossref   Medline   1st Citation  

Belay ED. Variant Creutzfeldt–Jakob disease death, United States. Emerg Infect Dis 2005:11:1351-4
Medline   1st Citation  

Beekes M, McBride, PA. Early accumulation of pathological PrP in the enteric nervous system and gut-associated lymphoid tissue of hamsters orally infected with scrapie. Neurosci Lett 2000:278:181-4
Crossref   Medline   1st Citation  

Büeler H, Aguzi, A, Sailer, A, Greiner, RA, Autenried, P, Aguet, M. Mice devoid of PrP are resistant to scrapie. Cell 1993:73:1339-47
Crossref   Medline   1st Citation  

Caughey B. Interactions between prion protein isoforms: the kiss of death? Trends Biochem Sci 2001:26:235-42
Crossref   Medline   1st Citation  

Corbeil D, Roper, K, Fargeas, CA, Joester, A, Huttner, WB. Prominin: a story of cholesterol, plasma membrane protrusions and human pathology. Traffic 2001:2:82-91
Crossref   Medline   1st Citation  

Dodelet VC, Cashman, NR. Prion protein expression in human leukocyte differentiation. Blood 1998:91:1556-61
Medline   1st Citation   2nd  

Drevot P, Langlet, C, Guo, XJ, Bernard, AM, Colard, O, Chauvin, JP. TCR signal initiation machinery is pre-assembled and activated in a subset of membrane rafts. EMBO J 2002:21:1899-908
Crossref   Medline   1st Citation  

Fantini J, Cook, DG, Nathanson, N, Spitalnik, SL, Gonzalez-Scarano, F. Infection of colonic epithelial cell lines by type 1 human immunodeficiency virus is associated with cell surface expression of galactosylceramide, a potential alternative gp120 receptor. Proc Natl Acad Sci U S A 1993:90:2700-4
Crossref   Medline   1st Citation   2nd  

Garmy N, Taïeb, N, Yahi, N, Fantini, J. Apical uptake and transepithelial transport of sphingosine monomers through intact human intestinal epithelial cells: physicochemical and molecular modeling studies. Arch Biochem Biophys 2005:440:91-100
Crossref   Medline   1st Citation   2nd  

Garmy N, Taïeb, N, Yahi, N, Fantini, J. Interaction of cholesterol with sphingosine: physicochemical characterization and impact on intestinal absorption. J Lipid Res 2005:46:36-45
Crossref   Medline   1st Citation  

Johnson RT, Gibbs, CJ. Creutzfeldt–Jakob disease and related transmissible spongiform encephalopathies. N Engl J Med 1998:339:1994-2004
Crossref   Medline   1st Citation   2nd   3rd   4th   5th  

Klein TR, Kirsch, D, Kaufmann, R, Riesner, D. Prion rods contain small amounts of two host sphingolipids as revealed by thin-layer chromatography and mass spectrometry. Biol Chem 1998:279:655-66
1st Citation  

Kong Q, Surewicz, WK, Petersen, RB, Zou, W, Chen, SG, Gambetti, P. Prion biology and diseases. 2004:673-775
1st Citation   2nd  

Lazarini F, Castelnau, P, Chermann, JF, Deslys, JP, Dormont, D. Modulation of prion protein gene expression by growth factors in cultured mouse astrocytes and PC-12 cells. Mol Brain Res 1994:22:268-74
Crossref   Medline   1st Citation  

Leitner T, Halapi, E, Scarlatti, G, Rossi, P, Albert, J, Fenyo, EM. Analysis of heterogeneous viral populations by direct DNA sequencing. BioTechniques 1993:15:120-7
Medline   1st Citation  

Li R, Liu, D, Zanusso, G, Liu, T, Fayen, JD, Huang, JH. The expression and potential function of cellular prion protein in human lymphocytes. Cell Immunol 2001:207:49-58
Crossref   Medline   1st Citation  

Livak KJ, Schmittgen, TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 2001:25:402-8
Crossref   Medline   1st Citation  

Lucia A, Cabral, B, Lee, KS, Martins, VR. Regulation of the cellular prion protein gene expression depends on chromatin conformation. J Biol Chem 2002:277:5675-82
Crossref   Medline   1st Citation  

Maignien T, Lasmezas, CI, Beringue, V, Dormont, D, Deslys, JP. Pathogenesis of the oral route of infection of mice with scrapie and bovine spongiform encephalopathy agents. J Gen Virol 1999:80:3035-42
Medline   1st Citation  

Martins VR, Linden, R, Prado, MAM, Walz, R, Sakamoto, AC, Izquierdo, I. Cellular prion protein: on the road for functions. FEBS Lett 2002:512:25-8
Crossref   Medline   1st Citation  

Melkonian KA, Ostermeyer, AG, Chen, JZ, Roth, MG, Brown, DA. Role of lipid modifications in targeting proteins to detergent-resistant membrane rafts. Many raft proteins are acylated, while few are prenylated. J Biol Chem 1999:274:3910-7
Crossref   Medline   1st Citation  

Mishra RS, Basu, S, Gu, Y, Luo, X, Zou, WQ, Mishra, R. Protease-resistant human prion protein and ferritin are cotransported across Caco-2 epithelial cells: implications for species barrier in prion uptake from the intestine. J Neurosci 2004:24:11280-90
Crossref   Medline   1st Citation   2nd   3rd   4th   5th  

Mobley WC, Neve, RL, Prusiner, SB, McKinley, MP. Nerve growth factor increases mRNA levels for the prion protein and the beta-amyloid protein precursor in developing hamster brain. Proc Natl Acad Sci U S A 1988:85:9811-5
Crossref   Medline   1st Citation  

Morel E, Fouquet, S, Chateau, D, Yvernault, L, Frobert, Y, Pinçon-Raymond, M. The cellular prion protein PrPc is expressed in human enterocytes in cell–cell junctional domains. J Biol Chem 2004:279:1499-505
Medline   1st Citation   2nd  

Morel E, Andrieu, T, Casagrande, F, Gauczynski, S, Weiss, S, Grassi, J. Bovine prion is endocytosed by human enterocytes via the 37 kDa/67 kDa laminin receptor. Am J Pathol 2005:167:1033-42
Medline   1st Citation   2nd   3rd  

Morré DJ, Morré, DM. Preparation of mammalian plasma membranes by aqueous two-phase partition. BioTechniques 1989:7:946-58
Medline   1st Citation  

Mouillet-Richard S, Laurendeau, I, Vidaud, M, Kellermann, O, Laplanche, JL. Prion protein and neuronal differentiation: quantitative analysis of PRNP gene expression in a murine inducible neuroectodermal progenitor. Microbes Infect 1999:1:969-76
Crossref   Medline   1st Citation  

Mouillet-Richard S, Ermonval, M, Chebassier, C, Laplanche, JL, Lehmann, S, Launay, JM. Signal transduction through prion protein. Science 2000:289:1925-8
Crossref   Medline   1st Citation  

Pammer J, Cross, HS, Frobert, Y, Tschlachler, E, Oberhuber, G. The pattern of prion-related protein expression in the gastrointestinal tract. Virchows Arch 2000:436:466-72
Crossref   Medline   1st Citation   2nd   3rd   4th   5th   6th   7th  

Pan KM, Baldwin, M, Nguyen, J, Gasset, M, Serban, A, Groth, D. Conversion of alpha-helices into beta-sheets features in the formation of the scrapie prion proteins. Proc Natl Acad Sci U S A 1993:90:10962-6
Crossref   Medline   1st Citation  

Peden AH, Head, MW, Ritchie, DL, Bell, JE, Ironside, JW. Preclinical vCJD after blood transfusion in a PRNP codon 129 heterozygous patient. Lancet 2004:264:527-9
1st Citation  

Petchanikow C, Saborio, GP, Anderes, L, Frossart, MJ, Olmedo, MI, Soto, C. Biochemical and structural studies of the prion protein polymorphism. FEBS Lett 2001:509:451-6
Crossref   Medline   1st Citation  

Petraroli R, Vaccari, G, Pocchiari, M. A rapid and efficient method for the detection of point mutations of the human prion protein gene (PRNP) by direct sequencing. J Neurosci Methods 2000:99:59-63
Crossref   Medline   1st Citation   2nd   3rd  

Prusiner SB. Novel proteinaceous infectious particles cause scrapie. Science 1982:216:136-44
Crossref   Medline   1st Citation  

Prusiner SB. Prions. Proc Natl Acad Sci U S A 1998:95:13363-83
Crossref   Medline   1st Citation   2nd   3rd   4th  

Thompsett AR, Abdelraheim, SR, Daniels, M, Brown, DR. High affinity binding between copper and full-length prion protein identified by two different techniques. J Biol Chem 2005:280:42750-8
Crossref   Medline   1st Citation  

Vey M, Pilkuhn, S, Wille, H, Nixon, R, DeArmond, SJ, Smart, EJ. Subcellular colocalization of the cellular and scrapie prion proteins in caveolae-like membranous domains. Proc Natl Acad Sci U S A 1996:93:14945-9
Crossref   Medline   1st Citation  

Wadsworth JDF, Asante, EA, Desbruslais, M, Linehan, JM, Joiner, S, Gowland, I. Human prion protein with valine 129 prevents expression of variant CJD phenotype. Science 2004:306:1793-6
Crossref   Medline   1st Citation  

Yahi N, Tamalet, C, Tourrès, C, Tivoli, N, Ariasi, F, Volot, F. Mutation patterns of the reverse transcriptase and protease genes in human immunodeficiency virus type 1-infected patients undergoing combination therapy: survey of 787 sequences. J Clin Microbiol 1999:37:4099-106
Medline   1st Citation  


Received 5 January 2006/9 February 2006; accepted 9 March 2006

doi:10.1016/j.cellbi.2006.03.006


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)