Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Download to Citation Manager
Cell Biology International (2008) 32, 8–15 (Printed in Great Britain)
Abstract
PDF
Citing articles
Human mesenchymal stem cells isolated from the umbilical cord
Chun Qiao, Wenrong Xu*, Wei Zhu, Jiabo Hu, Hui Qian, Qing Yin, Runqiu Jiang, Yongmin Yan, Fei Mao, Huan Yang, Xingzhong Wang and Yongchang Chen
School of Medical Technology, Centre for Clinical Laboratory Medicine of Affiliated Hospital, Jiangsu University, Zhenjiang Key Institute of Clinical Laboratory Medicine, 301 Xuefu Road, Zhenjiang, Jiangsu 212013, P.R. China

Abstract

Mesenchymal stem cells (MSCs) are known as a population of multi-potential cells able to proliferate and differentiate into multiple mesodermal tissues including bone, cartilage, muscle, ligament, tendon, fat and stroma. In this study human MSCs were successfully isolated from the umbilical cords. The research characteristics of these cells, e.g., morphologic appearance, surface antigens, growth curve, cytogenetic features, cell cycle, differentiation potential and gene expression were investigated. After 2weeks of incubation, fibroblast-like cells appeared to be dominant. During the second passage the cells presented a homogeneous population of spindle fibroblast-like cells. After more than 4months (approximately 26 passages), the cells continued to retain their characteristics. Flow cytometry analysis revealed that CD29, CD44, CD95, CD105 and HLA-I were expressed on the cell surface, but there was no expression of hematopoietic lineage markers, such as CD34, CD38, CD71 and HLA-DR. Chromosomal analysis showed the cells kept a normal karyotype. The cell cycle at the third passage showed the percentage of G0/G1, G2/M and S phase were 88.86%, 5.69% and 5.45%, respectively. The assays in vitro demonstrated the cells exhibited multi-potential differentiation into osteogenic and adipogenic cells. Both BMI-1 and nucleostemin genes, expressed in adult MSCs from bone marrow, were also expressed in umbilical cord MSCs. Here we show that umbilical cords may be a novel alternative source of human MSCs for experimental and clinical applications.

Keywords: Mesenchymal stem cells, Umbilical cord, Differentiation.

*Corresponding author. Fax: +86 511 503 8449.

1 Introduction

In recent years, multi-potential mesenchymal stem cells (MSCs) have become an attractive therapeutic tool because of their unique characteristics, such as their ability to be easily isolated and cultured and their high expansive potential ex vivo. Mesenchymal stem cells are able to be isolated from a wide variety of tissues, including bone marrow, adipose tissue, synovium, skeletal muscle, liver, cord blood, placenta and peripheral blood (Deans and Moseley, 2000; Jiang et al., 2002). However, bone marrow represents the main source of MSCs. Further more, MSCs have been shown to contain cells with multi-lineage potential under controlled in vitro conditions that mimic in vivo. These cells can differentiate into distinct types of mesenchymal cells including osteoblasts, chondroblasts, adipocytes and myoblasts, which contribute to the formation of mesenchymal tissues (bone, cartilage, muscle, marrow stroma, ligament, tendon, fat, dermis and connective tissue) (Schwartz et al., 2002; Xu et al., 2004). Therefore, further preclinical and clinical studies on the potential of mesenchymal stem cells are necessary for regenerative medicine, cellular immunotherapy and gene therapy (Wulf et al., 2006).

MSCs are not only present in bone marrow but also in the foetal environment (e.g., cord blood and placenta). Umbilical cord blood (UCB) is a source of additional stem cells for experimental and potentially clinical purposes. However, the presence of MSCs in UCB is controversial (Bieback et al., 2004; Kern et al., 2006). Placenta-derived cells also display multi-lineage differentiation potential similar to that of MSCs from bone marrow (Fukuchi et al., 2004; In 't Anker et al., 2004; Portmann-Lanz et al., 2006). The umbilical cord vein could be regarded as an alternative source of MSCs for experimental and clinical needs (Panepucci et al., 2004; Lu et al., 2006). Since MSCs are rarely found in bone marrow or foetal tissues, isolation and expansion of human mesenchymal stem cells appears to be crucial for their clinical applications. Our research attempts to establish a new method for isolating human MSCs derived from human umbilical cord, which could be able to differentiate into other tissues, such as osteogenic and adipogenic tissues, and to identify the characteristics of the isolated cells.

2 Materials and methods

2.1 Materials

2.1.1 Reagents

Low-glucose Dulbecco's modified Eagle's medium (DMEM), foetal bovine serum (FBS) and horse serum (HS) were purchased from Gibco (USA). Tyrode's solution and trypsin–EDTA were purchased from Sigma (St. Louis, MO). FITC-conjugated mouse anti-human antibodies (CD34, CD71, HLA-DR), PE-conjugated mouse anti-human antibodies (CD29, CD38, CD105, CD44 and HLA-I), FITC-conjugated mouse IgG1 and PE-conjugated mouse IgG1 were purchased from Becton Dickinson (San Jose, CA). Trizol reagent and reverse transcriptase–polymerase chain reaction (RT–PCR) kit were purchased from Invitrogen (Carlsbad, CA). Primers were synthesised by Shanghai Bio-Engineering Co. (Shanghai, China).

2.1.2 Equipment

CO2 Incubator (Forma Scientific), TE 300 inverted-type phase-contrast video microscope (TE 300, Nikon), Leica laser confocal microscope (Radiance 2100™, Bio-Rad), Flow Cytometer (FACS Calibur, BD), Gel Image Analysis System (Genius, SynGene), PCR Thermal Cycler (PCR Express Thermohybaid), Culture bottles and 24-well plates (Nunclon, Denmark).

2.2 Isolation of human umbilical cord MSCs

Fresh umbilical cords were collected from informed, consenting mothers and processed as quickly as possible. Moreover, the fresh umbilical cords were processed within the optimal processing period of 6h. The cords were rinsed twice by phosphate-buffered saline (PBS) in penicillin and streptomycin, the cord blood being removed during this process. The washed cords were cut into 1-mm2-sized pieces and floated in Dulbecco's modified Eagle's medium with low glucose (DMEM-LG) containing 10% FBS, 5% HS, penicillin and streptomycin. The pieces of cord were subsequently incubated at 37°C in humid air with 5% CO2. Non-adherent cells were removed by washing. The medium was replaced every 3days after the initial plating. When well developed colonies of fibroblast-like cells appeared after 10days the cultures were trypsinised and passaged (without dilution) into a new flask for further expansion and the medium changed every 3days. Human MSCs isolated and expanded from bone marrow were chosen as controls (Xu et al., 2004) and used for evaluation of the experimental results.

2.3 Morphology analysis

The cells harvested by trypsinisation were washed twice with PBS and then stained with the red fluorescent dye PKH26 (Sigma) according to the protocol of the supplier (Sigma). In brief, the washed cells were incubated with PKH26, which was added into 107 cells/ml at a concentration of 4μM, 25°C for 4min. The staining reaction was stopped by equimultiple 10% newborn bovine serum (NBS). All centrifugations and washing steps during the staining procedure were performed at room temperature. Cells were washed again in PBS and treated for 24 or 48h in serum-free medium. The cells were then stained with 1μg/ml DAPI for 15min and the fluorescence was analysed by Leica laser confocal microscope.

2.4 Flow cytometry

After the second passage, the cells were trypsinised (0.25% trypsin–EDTA), washed twice with 0.15mM PBS and stained on ice according to the recommendation of the manufacturer with the monoclonal antibodies, FITC-CD34, CD71, HLA-DR, PE-CD29, CD38, CD44, CD105 and HLA-I. In the control group PE-IgG1 and FITC-IgG1 were used as antibodies. The stained cells were analysed by flow cytometry.

2.5 Growth curves

In order to compare the growth curves with the MSCs of human bone marrow, the cells isolated from umbilical cords were seeded in 24-well plates (0.5×104/well). The number of the cells per well were counted every day for 12 successive days.

2.6 Genetics and DNA contents

Colchicine was added to the suspension of umbilical cord cells during the logarithmic growth phase. After incubation of 4–6h the cells were transferred to another tube and centrifuged at 150×g for 8min. The collected cells were treated with KCl (0.075M) for 15–30min, fixed with methanol/acetic acid (1:1 v/v) and then prepared for smear and Giemsa staining. The obtained MSCs were trypsinised and pelleted by centrifugation at 1000rpm. The pellets were washed twice with PBS and incubated after adding PI (500μl/106 cells) at room temperature for 15min. The percentages of the cells in G0/G1, G2/M and S phase cells were analysed using BD cell-quest software by flow cytometry.

2.7 Differentiation studies

The differentiation of the umbilical cord MSCs was assessed in cultures of the third passage. The cells were cultured in a medium which contained either osteogenic (0.1μM dexamethasone, 10μM β-glycerophosphate, and 50μM ascorbate-phosphate) or adipogenic (0.5μM isobutyl-methylxanthine, 1μM dexamethasone, 10μM insulin, and 200μM indomethacin) materials. All regents were from Sigma–Aldrich. Two weeks later, osteogenic differentiation was assessed by the examination of alkaline phosphatase activity and Von Kossa staining, and intracellular lipid accumulation was visualised using Oil-Red-O staining.

2.8 Reverse transcriptase–PCR (RT–PCR)

Before and after differentiation, the total RNA of MSCs generated from both human bone marrow and the umbilical cord were extracted by Trizol reagent (Invitrogen, USA). The cDNA was synthesised by using 4μg total RNA as the template and oligo dT as the primer with SuperScript™ II RT kit according to the instructions of the manufacturer (Invitrogen, USA). The thermal cycling profile for PCR was carried out at 94°C for 5min. This was followed by 35 cycles of 30s at 94°C, 30s at an annealing temperature and 30s at 72°C. An additional 10min of incubation at 72°C was also carried out after completion of the last cycle. The PCR products were size-fractioned by 2% agarose gel electrophoresis. The specific primers for PCR were designed as shown in Table 1.

Table 1.

Specific primers for target and control gene

Target/control genePrimer sequence (5′–3′)Annealing temperature (°C)Amplicon size (bp)
BMI-1For: AATCTAAGGAGGAGGTGA59359
Rev: CAAACAAGAAGAGGTGGA
nucleosteminFor: ACCTGAGGACATCTGCAACC61450
Rev: ACGCATGACCTGCCATAAGC
BMP-3For: GACCCTCCAATCCAACCA57255
Rev: ACGCTTTCAGGCTCACAA
PPARγ2For: GCCCAGGTTTGCTGAATG61650
Rev: TGAAGACTCATGTCTCTC
GAPDHFor: GGATTTGGTCGTATTGGG55205
Rev: GGAAGATGGTGATGGGATT

3 Results

3.1 Morphology and surface antigens

After the initial 3days of primary culture, human MSCs adhered to a plastic surface and presented a small population of single cells with spindle shape. On days 7–10 after initial plating, the cells looked like long spindle-shaped fibroblastic cells, began to form colonies and became confluent. After re-plating the fibroblast-like cells appeared polygonal or spindly with a long process (Fig. 1). Following staining with PKH26 and DAPI the cells were observed under a microscope. The umbilical cord MSCs displayed blue smooth nuclear and red cytoplasm within 20days (Fig. 2). The cells were considered normal on the basis of typical morphology. The MSCs were positive for CD13, CD29, CD44, CD105 and HLA-I but negative for CD34, CD38, CD71 and HLA-DR (Fig. 3).

Fig. 1

Morphological appearance of human umbilical cord MSCs. (A–C) The appearance and growth of MSCs colonies after 7, 10, and 15days of culturing, respectively. On days 7 to 15 after initial plating, the cells took on the appearance of long spindle-shaped fibroblastic cells, began to form colonies and became confluent. (D) The appearance of MSCs in the 26th passage. The umbilical cord stem cells retained their proliferative potentials with long passages. A–D: ×100.

Fig. 2

PKH26 and DAPI staining of human umbilical cord MSCs. (A,B) Umbilical cord MSCs appeared red in fluorescence within 20days. (C) Umbilical cord MSCs with blue smooth nuclear and red cell plasma. The cells were considered normal on the basis of typical morphology. A: ×100; B,C: ×200.

Fig. 3

The surface antigens of human umbilical cord MSCs. (A) Umbilical cord MSCs were positive for CD29, CD44, CD95, CD105 and HLA-I. (B) Umbilical cord MSCs were negative for CD34, CD38, CD71 and HLA-DR. The results confirmed that the cells were a kind of MSCs but non-hematopoietic cells.

3.2 Growth characteristics

The time for 1 passage was about 4–6days. After the cells were continually passaged for more than 4months (about 26 passages), they continued to retain their characteristics. The growth curves are shown in Fig. 4. The curves of umbilical cord MSCs were “S” type. After re-seeding the cells had 1day in an adaptive phase. Then the cells began to expand rapidly and move into the logarithmic phase of growth. Six days later, cell counts reached their highest level; this was followed by a plateau phase. According to the growth curve, the population doubling time of the cells was 26h, which was as fast as that of human bone marrow MSCs.

Fig. 4

Growth curve of umbilical cord MSCs and bone marrow MSCs. According to the growth curve, the population doubling time of umbilical cord MSCs was 26h, which was as fast as that of human bone marrow MSCs.

3.3 Genetics and cell cycle

The karyotype of human umbilical cord MSCs was normal (Fig. 5). The DNA contents also revealed similar results. Analysis for the cell cycle indicated that the third phases were: G0/G1 phase, 88.86%; G2/M phase, 5.69%; S phase, 5.45% (Fig. 6A). The 20th phases were: G0/G1 phase, 88.7%; G2/M phase, 3.52%; S phase, 7.78% (Fig. 6D). The 10th and 16th phases indicated the cells proliferated rapidly (Fig. 6B,C).

Fig. 5

Karyotype of umbilical cord MSCs. The karyotype of human umbilical cord MSCs was normal.

Fig. 6

DNA contents of human umbilical cord MSCs. (A–D) DNA contents of human umbilical cord MSCs of the 3rd, 10th, 16th and 20th passage, respectively. The results of the 16th and 20th passage indicated that they had propagated longer than MSCs from the other adult tissues. The cells became senile and diverse after the 20th passage yet proliferated slowly and passaged serially.

3.4 Differentiation of MSCs into osteocytes and adipocytes

With osteogenic supplementation the differentiation was apparent after 1week of incubation. By the end of the second week, part of the MSCs became alkaline phosphatase and Von Kossa positive (Fig. 7A,B). RT–PCR results showed that these cells highly expressed BMP-3 (Fig. 8). Similarly, the part of the cells which were induced with adipogenic medium contained numerous Oil-Red-O-positive lipid droplets (Fig. 7C) and expressed PPARγ2 (Fig. 8). Non-treated control cultures did not show spontaneous adipocyte or osteoblast formation even after 3–4weeks of cultivation (Fig. 7D).

Fig. 7

Differentiation potential of umbilical cord MSCs. (A,B) Results of alkaline phosphatase and Von Kossa detection in cell cultures growing within 2weeks in osteogenic medium, respectively. Part of the MSCs became alkaline phosphatase and Von Kossa positive. (C) Results of Oil-Red-O staining detection in cell cultures growing within 2weeks in adipogenic medium. Part of the cells contained numerous Oil-Red-O-positive lipid droplets. (D) Control cells growing in the regular medium. A,C: ×200; B,D: ×100.

Fig. 8

Gene expression of adult MSCs. Specific genes, such as nucleostemin, BMI-1, BMP-3 and PPARγ2 were detected from the cDNA of differentiated and undifferentiated umbilical cord MSCs. Adult MSCs associate genes, nucleostemin and BMI-1 were expressed in all MSCs. However, BMP-3, an osteogenic marker gene, was only expressed in the MSCs for osteogenic differentiation. PPARγ2, an adipogenic marker gene in the MSCs, was expressed for adipogenic differentiation. B-LCL and PBL were attached as negative controls for BMI-1 and nucleostemin, respectively. Endogenous “housekeeping” gene GAPDH was used as an internal control.

3.5 Expression of specific genes

Fig. 8 shows that adult MSCs associate genes nucleostemin and BMI-1 were expressed in all MSCs. However, BMP-3, an osteogenic marker gene, was only expressed in the MSCs for osteogenic differentiation. In addition, PPARγ2, an adipogenic marker gene in the MSCs, was tested for adipogenic differentiation. B lymphoblastoid cell line (B-LCL) and peripheral blood lymphocytes (PBL) were attached as negative controls for BMI-1 and nucleostemin, respectively (n=3 experiments).

4 Discussion

Mesenchymal stem cells offer a lot of promise for developing new alternative cell-based therapeutics. These unique cells possess two major features: their ability for self-renewal and differentiation potential. Furthermore, cells with mesenchymal stem characteristics can be derived and propagated in vitro from different organs and tissues (brain, heart, spleen, liver, kidney, lung, bone marrow, muscle, thymus, pancreas) (Beltrami et al., 2003; Alison et al., 2004; Laugwitz et al., 2005; Meirelles et al., 2006). Until now, it has been difficult to isolate human MSCs from most of the healthy tissues of the above organs. MSCs are generally isolated from an aspirate of bone marrow harvested from the superior iliac crest of the pelvis, the tibia and femur, and the thoracic and lumbar spine.

Their pharmacological importance is related to four points of mesenchymal stem cells and due to their ability to secrete biologically important molecules, express specific receptors, to be genetically manipulated and their susceptibility to molecules that modify their natural behaviour (Beyer Nardi and da Silva Meirelles, 2006). MSCs from the different tissue types present great potential in cellular therapies and in our quest for longevity (Majka et al., 2005). With the conventional limitation of MSCs isolation in mind, we have attempted to search for new sources of MSCs. We adopted the adherent culture method of human umbilical cords of term birth and have successfully isolated and identified a population of mesenchymal stem cells from the human umbilical cord. Moreover, we found the fresher the umbilical cord, the faster the rate of cell proliferation. The experiments were performed four times with consistent results. MSCs are non-hematopoietic stem cells with pluripotency. Umbilical cord is based upon body stalk and enwrapped by amnion, which consists of yolk bag, allantoid, two pieces of cord arteries and one piece of cord vein. The amnion contains ectoderm and mesoblast from the embryo. Usually, endothelial cells which are present in primary cultures do not affect the final outcome as the cells can not adhere to a plastic surface and proliferate for a long time without essential growth factors. Our results suggest that umbilical cord MSCs may originate from the sub-endothelial layer of the umbilical cord vein (Romanov et al., 2003). Whether the MSCs originate from amnion or smooth muscle requires further investigation. FCM analysis showed that these cells expressed the same surface antigens as bone marrow MSCs. The positive ratio weakened when the cells passaged for several months (not shown). The results confirmed that these cells were a kind of MSCs, but non-hematopoietic cells.

Martin et al. (2002) reported that MSCs were able to proliferate in vitro. The umbilical cord stem cells tendency for colony growth with long passages (4months) indicates their proliferative potentials. The PKH26 and DAPI stained cells demonstrated that the cells have the normal morphology, which contain the same smooth nucleus with spindle shape as the bone marrow MSCs. The results of DNA contents of the 16th and 20th passage indicated that they have propagated longer than MSCs from the other adult tissues. The cells became senile and diverse after the 20th passage yet proliferated slowly and passaged serially.

To investigate the differentiation potential of MSCs derived from the umbilical cord, we used MSCs of the third passage to culture in the conditions that favoured osteogenic and adipogenic differentiation of MSCs. Results indicated that the MSCs could differentiate into osteocytes and adipocytes that present ALP, Von Kossa, Oil-Red-O positive staining in plasma and expressed, in addition, different osteogenic and adipogenic marker genes such as BMP-3 and PPARγ2. Our experiments revealed that the MSCs cultured in adipogenic differentiation medium led to the appearance of rounded cells. These cells presented numerous fat vacuoles in cytoplasm visualised by Oil-Red-O staining.

Some associated genes were selected to search for the differences between MSCs derived from bone marrow and those derived from the umbilical cord. Nucleostemin is a novel p53 binding protein localised in the nucleoli of stem cells but absent from committed and terminally differentiated cells (Tsai and Mckay, 2002). BMI-1 is capable of self-renewal and could restrain the senescence of MSCs (Bea et al., 2001). The nucleostemin and BMI-1 mRNA was expressed in the human umbilical cord MSCs as well as bone marrow MSCs. In order to confirm the specificity of RT–PCR products for nucleostemin and BMI-1, DNA sequencing of PCR products was performed. The results indicated that products of RT–PCR for nucleostemin and BMI-1 were completely homologous to the sequence from GenBank (NM175580, NM005180). These findings suggested that MSCs of different sources had similar characteristics of gene expression.

In conclusion, umbilical cord MSCs have been established and characterised as a new human MSC cell line. This is a significantly different approach from previous reports in which the vasculature and its surrounding tissue have been discarded. We have taken a method for isolating MSCs without collagenase which may affect the proliferation and differentiation of MSC. Our results indicate that the isolation method is significantly different from others reported (Wang et al., 2004; Baksh et al., 2007). However, the identification of umbilical cord MSCs is similar to theirs in differentiation potential. These cells retain the morphologic, biologic and cytogenetic characteristics of human bone marrow mesenchymal stem cells in vitro, with expression of nucleostemin and BMI-1. The umbilical cord MSCs may provide evidence for the theory that stem cells might originate from many tissues. Compared to bone marrow MSCs, umbilical cord MSCs are easier to isolate and expand. Our harvesting procedure is more consistent and yields a greater number of relevant cells than results achieved from the other more primitive tissues. Our findings indicate that umbilical cord MSCs are a novel source of adult mesenchymal stem cells. Umbilical cord MSCs may play an important role in applications and experimental research of adult human MSCs.

Acknowledgements

We thank Professor Qi Ming and Olivia Lindsey for helpful discussion and critical reading of the manuscript. This work was supported by National Natural Science Foundation of China grant 30471938, Natural Science Foundation of Ministry of Public Health of China Grant WKJ 2005-2-024, Jiangsu Province's Outstanding Medical Academic Leader program, Foundation of Zhenjiang Key Institute of Clinical Laboratory Medicine Grants SH2006066, SH2006070, The Natural Science Foundation of the Jiangsu Province, grant no. BK2007705, and BK2007092.

References

Alison MR, Vig, P, Russo, F, Bigger, BW, Amofah, E, Themis, M. Hepatic stem cells: from inside and outside the liver? Cell Prolif 2004:37:1-21
Crossref   Medline   1st Citation  

Baksh D, Yao, R, Tuan, RS. Comparison of proliferative and multilineage differentiation potential of human mesenchymal stem cells derived from umbilical cord and bone marrow. Stem Cells 2007:25:1384-92
Crossref   Medline   1st Citation  

Bea S, Tort, F, Pinyol, M, Puig, X, Hernandez, L, Hernandez, S. BMI-1 gene amplification and overexpression in hematological malignancies occur mainly in mantle cell lymphomas. Cancer Res 2001:61:2409-12
Medline   1st Citation  

Beltrami AP, Barlucchi, L, Torella, D, Baker, M, Limana, F, Chimenti, S. Adult cardiac stem cells are multipotent and support myocardial regeneration. Cell 2003:114:763-76
Crossref   Medline   1st Citation  

Beyer Nardi N, da Silva Meirelles, L. Mesenchymal stem cells: isolation, in vitro expansion and characterization. Handb Exp Pharmacol 2006:174:249-82
Medline   1st Citation  

Bieback K, Kern, S, Kluter, H, Eichler, H. Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood. Stem Cells 2004:22:625-34
Crossref   Medline   1st Citation  

Deans RJ, Moseley, AB. Mesenchymal stem cells: biology and potential clinical uses. Exp Hematol 2000:28:875-84
Crossref   Medline   1st Citation  

Fukuchi Y, Nakajima, H, Sugiyama, D, Hirose, I, Kitamura, T, Tsuji, K. Human placenta-derived cells have mesenchymal stem/progenitor cell potential. Stem Cells 2004:22:649-58
Crossref   Medline   1st Citation  

In 't Anker PS, Scherjon, SA, Kleijburg-van der Keur, C, de Groot Swings, GM, Claas, FH, Kanhai, HH. Isolation of mesenchymal stem cells of fetal or maternal origin from human placenta. Stem Cells 2004:22:1338-45
Crossref   Medline   1st Citation  

Jiang Y, Jahagirdar, BN, Reinhardt, RL, Schwartz, RE, Keene, CD, Ortiz-Gonzalez, XR. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002:418:41-9
Crossref   Medline   1st Citation  

Kern S, Eichler, H, Stoeve, J, Kluter, H, Bieback, K. Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue. Stem Cells 2006:24:1294-301
Crossref   Medline   1st Citation  

Laugwitz KL, Moretti, A, Lam, J, Gruber, P, Chen, Y, Woodard, S. Postnatal isl1+ cardioblasts enter fully differentiated cardiomyocyte lineages. Nature 2005:433:647-53
Crossref   Medline   1st Citation  

Lu LL, Liu, YJ, Yang, SG, Zhao, QJ, Wang, X, Gong, W. Isolation and characterization of human umbilical cord mesenchymal stem cells with hematopoiesis-supportive function and other potentials. Haematologica 2006:91:1017-26
Medline   1st Citation  

Majka M, Kucia, M, Ratajczak, MZ. Stem cell biology—a never ending quest for understanding. Acta Biochim Pol 2005:52:353-8
Medline   1st Citation  

Martin DR, Cox, NR, Hathcock, TL, Niemeyer, GP, Baker, HJ. Isolation and characterisation of multi-potential mesenchymal stem cells from feline bone marrow. Exp Hematol 2002:30:879-86
Crossref   Medline   1st Citation  

Meirelles LD, Chagastelles, PC, Nardi, NB. Mesenchymal stem cells reside in virtually all post-natal organs and tissues. J Cell Sci 2006:119:2204-13
Crossref   Medline   1st Citation  

Panepucci RA, Siufi, JL, Silva, WA, Proto-Siquiera, R, Neder, L, Orellana, M. Comparison of gene expression of umbilical cord vein and bone marrow-derived mesenchymal stem cells. Stem Cells 2004:22:1263-78
Crossref   Medline   1st Citation  

Portmann-Lanz CB, Schoeberlein, A, Huber, A, Sager, R, Malek, A, Holzgreve, W. Placental mesenchymal stem cells as potential autologous graft for pre- and perinatal neuroregeneration. Am J Obstet Gynecol 2006:194:664-73
Crossref   Medline   1st Citation  

Romanov YA, Svintsitskaya, VA, Smirnov, VN. Searching for alternative sources of post-natal human mesenchymal stem cells: candidate MSC-like cells from umbilical cord. Stem Cells 2003:21:105-10
Crossref   Medline   1st Citation  

Schwartz RE, Reyes, M, Koodie, L, Jiang, Y, Blackstad, M, Lund, T. Multipotent adult progenitor cells from bone marrow differentiate into functional hepatocyte-like cells. J Clin Invest 2002:109:1291-302
Medline   1st Citation  

Tsai RY, Mckay, RD. A nucleolar mechanism controlling cell proliferation in stem cells and cancer cells. Genes Dev 2002:16:2991-3003
Crossref   Medline   1st Citation  

Wang HS, Hung, SC, Peng, ST, Huang, CC, Wei, HM, Guo, YJ. Mesenchymal stem cells in the Wharton's jelly of the human umbilical cord. Stem Cells 2004:22:7:1330-7
Crossref   Medline   1st Citation  

Wulf GG, Chapuy, B, Trumper, L. Mesenchymal stem cells from bone marrow. phenotype. aspects of biology, and clinical perspectives. Med Klin (Munich) 2006:101:408-13
Crossref   Medline   1st Citation  

Xu W, Zhang, X, Qian, H, Zhu, W, Sun, X, Hu, J. Mesenchymal stem cells from adult human bone marrow differentiated into cardiomyocytes in vitro. Exp Biol Med (Maywood) 2004:229:623-31
Medline   1st Citation   2nd  

Received 2 February 2007/19 June 2007; accepted 10 August 2007

doi:10.1016/j.cellbi.2007.08.002
CBI home
Browse archive
Search
ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)