Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2008) 32, 456–461 (Printed in Great Britain)
Differentiation of embryonic stem cells towards pancreatic progenitor cells and their transplantation into streptozotocin-induced diabetic mice
Chunhua Chena, Yuebo Zhangb, Xiaoyan Shengb, Cheng Huangb and Ying Qin Zangb*
aInstitute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 225 South Chongqing Road, Shanghai 200025, China
bInstitute for Nutritional Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 319 Yue Yang Road, Shanghai 200031, China


Abstract

Type I diabetes is characterized by the deficiency of endocrine β cells in the pancreatic islets of Langerhans and transplantation of islet cells can be an effective therapeutic approach. Embryonic stem cells can be differentiated into any cell type, and therefore represent an unlimited source of islet cells for the transplantation and treatment for type I diabetes. We have adopted an easy and reproducible in vitro differentiation system with a reduced serum concentration plus nicotinamide to generate early pancreatic progenitor cells from embryonic stem cells. Gene expression analysis indicated that the differentiated cells expressed not only endoderm markers such as GATA-4, HNF-3β, but also early markers of pancreatic development including key transcription factors PDX-1 and IAPP. Some pancreatic specific markers, such as insulin I, insulin II, Glu-2 and glucagon, were also expressed to some extent at the mRNA level. Differentiated ES cells showed low level immunoreactivity for insulin. However, transplantation of these early pancreatic progenitor clusters into STZ-induced diabetic mice failed to reverse the hyperglycemic state of the disease as reported previously. The results suggest that culture manipulation can direct ES cells to differentiate into early pancreatic progenitor cells committing to pancreatic islet cell fate, but these cells cannot function normally to reduce blood glucose of diabetic mice at this stage.


Keywords: Embryonic stem cell, Differentiation, Pancreatic progenitor, Type I diabetes, Streptozotocin, Transplantation.

*Corresponding author. Tel./fax: +86 21 5492 0913.


1 Introduction

Diabetes mellitus is a heterogeneous metabolic disorder affecting 5% of the adult population. Diabetes mellitus can be classified broadly into two groups: the insulin-dependent type (IDDM or type I) and the non-insulin-dependent type (NIDDM or type II). Type I diabetes is usually results from autoimmune-mediated destruction of insulin-secreting β cells in the islets of Langerhans of the pancreas, whereas Type II diabetes may be caused by systemic insulin resistance and reduced insulin secretion by pancreatic β cells.

Despite intensive insulin therapy, most individuals with type I diabetes are unable to maintain a blood glucose level in the normal range at all times. Transplantation of pancreatic islet cells can be a promising therapeutic option for the treatment of insulin-dependent diabetes. However, the lack of suitable donor tissues remains a major obstacle. Although transplantation of the whole pancreas or isolated islets of Langerhans is an effective strategy, it remains limited due to the low availability of human donor pancreas (Shapiro et al., 2000).

A promising alternative for the generation of pancreatic islets is the utilization of embryonic stem (ES) cells. ES cells are derived from the inner mass of the mammalian blastocyst, and are characterized by their self-renewal capacity and the ability to retain their developmental capacity in vivo (Bradley et al., 1984) and in vitro (Keller, 1995). To date, it has been reported that ES cells can be differentiated into insulin-producing cells by manipulating culture conditions in vitro. Several approaches have been used to obtain insulin-secreting cells: the selection for nestin-expressing ES cells (Lumelsky et al., 2001; Soria et al., 2000; Hori et al., 2002); overexpression of key transcription factors Pax4 (paired box gene 4) or PDX-1 (pancreatic and duodenal homeobox factor-1) (Blyszczuk et al., 2003; Miyazaki et al., 2004); and cell trapping with antibiotic resistance driven by the Nkx6.1 or insulin promoter to select cells (Soria et al., 2000; Leon-Quinto et al., 2004).

Although these studies suggested that mouse ES cells could be manipulated to express and secrete insulin in vitro, insulin-producing cell clusters derived from ES cells in these initial reports were obtained in a small quantity and these cells had lower insulin level when compared to pancreatic islets.

In the study, the differentiated protocol with reduced serum plus nicotinamide was used to promote the differentiation of ES cells towards progenitor cells of early pancreatic development. Then direct implantation of the differentiated clusters into STZ-induced diabetic mice was carried out in a hope that transplantation of early progenitor cells fully expressing β-cell markers can ameliorate hyperglycemia in diabetes.

2 Materials and methods

2.1 Animals

Male C57BL/6 mice, 7–8weeks of age, were purchased from Shanghai SLAC Laboratory (Shanghai, China). Mice were kept under controlled temperature (22–23°C) and on a 12h light/dark cycle with free access to water and pelleted food. Care and maintenance of all animals were in accordance with the Institutional Animal Care and Use Committee (IACUS) guidelines set by the Shanghai Institutes for Biological Sciences.

2.2 Culture of mouse embryonic stem cells

The D3 cell line was kindly supplied by Dr Y Jin and maintained on a mitomycin-C (Sigma, St. Louis, MO, USA)-treated mouse embryonic fibroblast (MEF) feeder layer. ES cells were cultured in high-glucose Dulbecco's modified Eagle's medium (DMEM) (Hyclone, Logan, UT, USA) containing 15% fetal bovine serum (FBS) (Hyclone), 2mmol/L l-glutamine, 0.1mmol/L β-mercaptoethanol, 1% non-essential amino acid, 1mmol/L sodium pyruvate, 100IU/ml penicillin and 100μg/ml streptomycin (Gibco BRL, Grand Island, NY, USA), 1000U/ml mouse recombinant leukemia inhibitory factor (LIF, Chemicon, Tenecula, CA, USA). Cells were grown in 5% CO2 in air at 95% humidity. The culture medium was refreshed daily and cells were passaged every 2days.

2.3 Differentiation of ES cells in vitro

To induce differentiation, ES cells were transferred and grown on gelatinized dishes for 2 passages to deplete feeder cells. For the generation of embryoid bodies (EBs), ES cells were trypsinized into a single-cell suspension, washed twice, and plated at 1×105 cells in 35mm bacteriological Petri dishes with differentiation medium containing Dulbecco's modified Eagle's medium (DMEM; Hyclone, Logan, UT, USA), 2mmol/L l-glutamine, 1% non-essential amino acid, and 3% FCS. On day 6 of EB formation, the resulting embryoid bodies were plated onto gelatin-coated 6-well plates and allowed outgrowth and differentiation for 10days in the medium with 10% FBS, plus 10mmol/L nicotinamide (Sigma, USA). The cultured medium was changed every day.

2.4 Real-time PCR

Total RNA was isolated from cell pellets using RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Genomic DNA was removed from total RNA using the RNase-free DNase set (Qiagen). The first strand cDNA was synthesized by using Sensiscript RT Kit (Qiagen). Random hexamers were used to prime cDNA synthesis. The gene expression levels were performed by real-time PCR using SYBR Green master mix (Applied Biosystems, Foster City, CA, USA). Thermocycler conditions comprised an initial holding at 50°C for 2min, and 95°C for 10min followed by a two-step PCR program consisting of 95°C for 15s, and 60°C for 60s for 40 cycles. Data were collected and quantitatively analyzed on an ABI Prism 7900 sequence detection system (Applied Biosystems). The β-actin gene was used as an endogenous control to normalize for differences in the amount of total RNA in each sample. All quantities were expressed as number of folds relative to the expression of β-actin. The sequences of primers were showed in the Table 1. Primers for real-time PCR were synthesized in Invitrogen Biotechnology.


Table 1.

The primer sequence used for real-time PCR

Gene nameAcc NumForward primerReverse primer
β-actinX 03672TGTCCACCTTCCAGCAGATGTAGCTCAGTAACAGTCCGCCTAGA
Insulin INM_008386ACAACTGGAGCTGGGAGGAAAAATGCTGGTGCAGCACTGA
Insulin IINM_008387ACCCAGGCTTTTGTCAAGCACGGGACATGGGTGTGTAGAAG
Glut2NM_031197AGCAATGTTGGCTGCAAACACACTTCGTCCAGCAATGATGA
PDX-1NM_008814TTCCAAAACCGTCGCATGACAATCTTGCTCCGGCTCTTC
GlucagonNM_008100CCACTCACAGGGCACATTCATCCGGTTCCTCTTGGTGTTC
IAPPNM_010491ACAACGCCTGGCAAACTTTTCCGCATTCCTCTTGCCATAT
GATA-4NM_008092AAGGCTATGCATCTCCTGTCACTCGGTGATTATGTCCCCATGACT
HNF-3βNM_010446CAGAGCCCCAACAAGATGCTGAGAGTGGCGGATGGAGTTC
OCT-4NM_013633CTCACCCTGGGCGTTCTCTGGCCGCAGCTTACACATGTT


2.5 Immunofluorescence analysis

Cells were fixed with 4% paraformaldehyde and permeabilised with 0.1% Triton X-100. The primary antibody, Guinea Pig anti-insulin antibody (Zymed, CA, USA), was used without dilution. For detection of the primary antibody, a fluorescent-labeled secondary antibody, Rabbit anti-Guinea Pig antibody conjugated with FITC (Zymed, USA), was utilized according to the manufacturer's instructions.

2.6 Transplantation of ES-derived pancreatic progenitor

Male C57BL/6 mice, aged 7–8weeks, were used as recipients of the implantation. Diabetic model in male C57BL/6 was induced with multiple intraperitoneal injection of streptozotocin (STZ) for 5days consecutively (Sigma). The final dosage of streptozotocin is 50mg/kg of body weight, and the streptozotocin was freshly dissolved in citrate buffer (pH=4.5). Blood-glucose level was measured from tail blood between 9 and 11 AM under non-fasting conditions, using a portable glucose meter (Bayer, Leverkusen, Germany). Three days after the first injection of STZ, 5 diabetic mice were implanted with the ES-derived early progenitor cells and 5 mice were sham operated as diabetic controls. With the mice under general anesthesia, the left kidney was exposed from the back of mice through a lumbar incision, and 5×106 million cells were injected into the renal subcapsular space. Mice were monitored every 2days for blood glucose levels and weight.

2.7 Statistical analysis

All experiments were repeated 3 times. Statistical differences were determined by analysis of variance. The values of P<0.05 were considered significant.

3 Results

3.1 Differentiation of ES cells

To induce the differentiation of ES cells into early pancreatic precursors, we used a reduced serum in differentiation protocol described above. Fig. 1 showed the typical morphological change of the ES cells in different state of the culture. Undifferentiated ES cells were cultured in the presence of LIF (Fig. 1A) and then the ES cells were allowed to form aggregates (EBs) for 6days in the bacteriological Petri dishes without adding LIF in the medium (Fig. 1B). The resulting EBs were transferred to the tissue culture dish and spread around for 10days (EB outgrowth on day 10 shown in Fig. 1C).


Fig. 1

Cell morphology change during ES culture and differentiation. A: undifferentiated ES cells were grown on irradiated embryonic fibroblasts in the presence of LIF. B: Embryoid bodies were grown in suspension for 6days in the absence of LIF. C: Outgrowth of EBs for 10days after plating on the tissue culture dishes (Bar=100μm).


3.2 Gene expression during in vitro differentiation

To clarify the characteristic features of the differentiated clusters, we analyzed the gene expression of a variety of early endoderm markers and pancreatic specific markers using real-time PCR. In order to compare the gene expression patterns at different time points, the expression pattern was divided into 3 stages: the first stage is in the undifferentiated period (D3); the second stage is in the EBs formation period (EBs); and the third stage is in the plate period during when EBs were plated on the tissue culture dishes for 10days (Plate). Min6 cells were used as a positive control. The undifferentiated D3 cells expressed high level of Oct-4 at the undifferentiated stage (Fig. 2). As the differentiated period proceeds, Oct-4 expression gradually decreased (Fig. 2A). Other makers were undetectable in undifferentiated ES cells but present in differentiated ES cell progeny. The definitive endoderm markers GATA-4 and HNF-3β started to be expressed in the EBs stage, and increased substantially after EBs plating (Fig. 2B). The key transcription factor PDX-1 of early pancreatic development and islet amyloid polypeptide (IAPP), which is a marker of early progenitor cells committed to definitive islet lineages, appeared in the EBs stage and was quickly upregulated in the Plate stage (Fig. 2C). In the Plate stage, pancreatic specific markers insulin I, insulin II and glucagon, but not the glucose transporter-2 (GLUT 2), were significant increased in expression compared with the EBs stage (Fig. 2D). These results suggest that the differentiated clusters are early pancreatic progenitor cells that express most of the markers.


Fig. 2

Real-time PCR analysis of gene expression during in vitro differentiation. Total RNA was extracted from ES cells and differentiated cell clusters at different stages and subjected to real-time PCR. Stage 1 cells are undifferentiated ES cells (D3). Stage 2 cell clusters are EBs cultured in the absence of LIF (EBs). Stage 3 cell clusters are outgrowth of EBs for 10days after plating (Plate). MIN 6 cells are as positive control. A: Expression of undifferentiated ES cells marker Oct-4 at differentiation stages. B: Expression of definitive endoderm markers GATA-4 and HNF-3β at differentiation stages. C: Expression of early pancreas development marker PDX-1 and IAPP at differentiation stages. D: Expression of pancreatic specific markers at differentiation stages.


3.3 Immunocytochemistry for insulin

To determine the presence of endogenously produced insulin in the early pancreatic progenitor cells, immunocytochemistry assay was performed using an antibody specific for insulin, and insulinoma cells were used as a positive control. Positive staining for insulin was detected in the differentiated cell cultures (Fig. 3A), although the immunoreactivity for insulin was lower than in MIN6 cells (Fig. 3B). The data suggests that insulin production was at least present in the differentiated progenitor cells at this stage.


Fig. 3

Immunocytochemistry for insulin. A: Immunofluorescence staining of the EBs outgrowths on day 10 with insulin Guinea Pig antibody and Rabbit anti-Guinea Pig antibody conjugated with FITC, along with DAPI nuclear staining. B: Insulin immunoreactivity for MIN 6 cells as positive control.


3.4 Transplantation of differentiated ES clusters to diabetic mice

Multiple treatments of STZ induced a stable diabetic state in C57BL/6 mice, with blood glucose concentrations >15mmol/L. Three days after the first STZ injection, we transplanted the early pancreatic precursors derived from ES cells into the kidney capsule. Blood glucose level was closely monitored for all treated mice and controls, none of which showed any significant reduction (Fig. 4).


Fig. 4

Blood glucose levels after transplantation of ES-derived early pancreatic progenitor cells into diabetic mice left renal capsule. Blood glucose was obtained from the snipped tail and measured between 9 and 11 AM. Three days after the injection of STZ, 5 diabetic mice were implanted with the ES-derived early progenitor cells and 5 mice were sham operated and kept as diabetic controls. Arrow indicates the implantation day.


4 Discussion

The pluripotency of ES cells to develop into a wide range of cell types has drawn attention to their potential as a novel source of cell transplantation. ES cells might represent a limitless source of specific cell types for transplantation. Under appropriate culture conditions, ES cells differentiate into embryoid bodies that contain derivatives of all three germ cell layers. Recently, several studies have provided evidence for endoderm development in ES differentiation cultures, and demonstrated the generation of insulin-expressing cell (Lumelsky et al., 2001; Soria et al., 2000; Hori et al., 2002; Blyszczuk et al., 2003). ES differentiation into islet-like cells has been promoted by modifying the culture condition or adding various growth factors or cytokines.

To induce specific differentiation of ES cells, we determined the appropriate culture conditions to get them to differentiate into early pancreatic progenitor cells. Otonkoski et al. (1993) reported that nicotinamide induced the in vitro differentiation and maturation of cultured human fetal pancreatic islet cells and enhanced the expression of insulin, glucagon and somatostatin. Nicotinamide is a form of vitamin B3 which, through its major metabolite NAD+ (nicotinamide adenine dinucleotide), is involved in a wide range of biological processes, including the production of energy, nutrient metabolism, signal transduction, as well as maintenance of the integrity of the genome (Di Lisa and Ziegler, 2001). The differentiation potential of nicotinamide has been exploited in differentiation protocols to obtain insulin-producing cells. Vaca et al. (2003) adopted a differentiation protocol with a reduced serum concentration plus nicotinamide during differentiation. Both nicotinamide and nutrient restriction increased insulin content and improved the last steps in the maturation process during differentiation (Vaca et al., 2003). In 2004, Kubo et al. (2004) found that endoderm could be induced in EBs by limited exposure to serum or treatment with activin A under serum-free conditions. Based on these studies, we adopted an easy and reproducible in vitro differentiation system with a reduced serum concentration plus nicotinamide to generate early pancreatic progenitor cells from embryonic stem cells.

In the ES differentiated stage, we analyzed the gene expression of transcription factors involved in the development of the pancreas using real-time PCR. We found that markers of definitive endoderm such as GATA-4 and HNF-3β started to express in the EBs stage and peaked in the Plate stage. Hepatocyte nuclear factor 3 beta (HNF-3β), a critical factor in the endodermal cell lineage development, is a transcriptional regulator of PDX-1 (Zaret, 1996; Wu et al., 1997). HNF-3β is expressed by definitive endoderm in the early developing embryo, as well as in the notochord and the floor plate of the neurotube (Ang and Rossant, 1994). Thus, at the early differentiated stage, HNF-3β may be an indicator of both neuronal and endoderm differentiation. GATA-4 is also known as a marker of definitive endoderm. PDX-1, an important transcription factor of early pancreas, was detectable in the EBs stage and the expression level was increased in the Plate stage. The pancreatic transcription factor PDX-1, is a key player in pancreas ontogenesis and mature beta-cell physiology (Jonsson et al., 1994; Ahlgren et al., 1998). PDX-1 is expressed in the pancreatic endoderm and is essential for its early development, but later becomes restricted to a beta-cell fate. IAPP, as a marker of early pancreatic progenitor cells, was markedly upregulated in the Plate stage. IAPP is co-produced and co-secreted with insulin from islet cells in the normal pancreas (Hanabusa et al., 1992). Previous studies have demonstrated that IAPP are expressed by all 4 islet cell types as they first emerge during development, suggesting that they may mark a common progenitor cell (Mulder et al., 1998; Wilson et al., 2002). Our results indicated ES cells differentiated toward early pancreatic progenitor cells under such conditions over time.

The differentiated clusters also expressed various genes related to pancreatic islets including insulin I, insulin II, GlUT-2 and glucagon, suggesting that they further differentiated toward pancreatic islet cells with time. In rodents there are 2 non-allelic insulin genes, insulin I and insulin II, which are both expressed and regulated in beta cells (Melloul et al., 2002). Insulin I expression is restricted to beta cells, whereas insulin II is more broadly expressed. Glucagon is secreted by pancreatic α cells, which can act as a marker for pancreatic α cells. In the differentiation process of islet endocrine cells, glucagon-positive cells are the earliest hormone-positive cells (Slack, 1995), consistent with the early presence of glucagon-positive cells in pancreatic bud epithelium in vivo (Kahan et al., 2003). In the Plate stage, glucagon and insulin expression was significantly higher in comparison with the EBs stage. GLUT-2 is an essential gene that plays an important role in pancreatic β-cell functions, including glucose-stimulated insulin secretion (Guillam et al., 2000; Thorens et al., 2000). In the Plate stage, GLUT-2 expression level was lower than other pancreatic markers. In our study, insulin mRNA expression in early differentiated progenitor cells was also observed, but at a much lower concentration than in MIN6 cells, an insulinoma cell line derived from in vivo immortalized insulin-secreting pancreatic beta cells, which showed high expression levels of insulin I, PDX-1, and especially insulin II. Consistent with mRNA expression, immunocytochemistry analysis demonstrated positive insulin staining in the early differentiated ES cells by fluorescence microscopy, although the intensity was relatively lower than in MIN6 cells. Since we preferred to differentiate ES into the early progenitor cells not insulin-secreting cells, one can explain that the differentiated cells expressed lower level of insulin than that in MIN6 cells. These results suggest that early pancreatic progenitor cells expressed not only endoderm markers and early markers of pancreatic development, but also to a certain extent specific pancreatic markers.

We have demonstrated the possibility that ES cells can differentiate into early pancreatic progenitor cells committed to becoming islet cells under the appropriate protocol; and also that in vivo these can differentiate after the transplantation of early progenitor cells into the STZ-induced diabetic mice. We expect that these early pancreatic progenitor cells were able to differentiate towards islet β cells after being transplanted into the kidney capsule, which seems a suitable for location for this to occur. Although these clusters carry some of the characters of mature pancreatic β cells, they failed to reverse the hyperglycemia that persisted in the diabetic mice. These early differentiated cells may not, however, function properly in a manner similar to the pancreatic β cells. Since the mouse ES cell line D3 was derived from 129/Sv blastocyst and the transplant recipient mice were C57BL/6, immune rejection might also be involved. All these factors may stop any further differentiation of the implanted cells.

In conclusion, the differentiation protocol for pancreatic progenitor cells may represent a basic pathway for mouse ES differentiation toward pancreatic cells in vitro. However, further study is needed to characterize more thoroughly and improve these progenitor cells before they can be put to any therapeutic use in the treatment for diabetes.

Acknowledgements

We thank Dr Ying Jin of Institute of Health Sciences for providing the mouse D3 cell line. This work was partially supported by the Hundred Talent Project of Chinese Academy of Sciences.

References

Ahlgren U, Jonsson, J, Jonsson, L, Simu, K, Edlund, H. Beta-cell-specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the beta-cell phenotype and maturity onset diabetes. Genes Dev 1998:12:1763-8
Crossref   Medline   1st Citation  

Ang SL, Rossant, J. HNF-3 beta is essential for node and notochord formation in mouse development. Cell 1994:78:561-74
Crossref   Medline   1st Citation  

Blyszczuk P, Czyz, J, Kania, G, Wagner, M, Roll, U, St-Onge, L. Expression of Pax4 in embryonic stem cells promotes differentiation of nestin-positive progenitor and insulin-producing cells. Proc Natl Acad Sci 2003:100:998-1003
Crossref   Medline   1st Citation   2nd  

Bradley A, Evans, M, Kaufman, MH, Robertson, E. Formation of germ-line chimaeras from embryo-derived teratocarcinoma cell lines. Nature 1984:309:255-6
Crossref   Medline   1st Citation  

Di Lisa F, Ziegler, M. Pathophysiological relevance of mitochondria in NAD(+) metabolism. FEBS Lett 2001:492:4-8
Crossref   Medline   1st Citation  

Guillam MT, Dupraz, P, Thorens, B. Glucose uptake, utilization, and signaling in GLUT2-null islets. Diabetes 2000:49:1485-91
Crossref   Medline   1st Citation  

Hanabusa T, Kubo, K, Oki, C, Nakano, Y, Okai, K, Sanke, T. Islet amyloid polypeptide (IAPP) secretion from islet cells and its plasma concentration in patients with non-insulin-dependent diabetes mellitus. Diabetes Res Clin Pract 1992:15:89-96
Crossref   Medline   1st Citation  

Hori Y, Rulifson, IC, Tsai, BC, Heit, JJ, Cahoy, JD, Kim, SK. Growth inhibitors promote differentiation of insulin-producing tissue from embryonic stem cells. Proc Natl Acad Sci 2002:99:16105-10
Crossref   Medline   1st Citation   2nd  

Jonsson J, Carlsson, L, Edlund, T, Edlund, H. Insulin-promoter-factor 1 is required for pancreas development in mice. Nature 1994:371:606-9
Crossref   Medline   1st Citation  

Kahan BW, Jacobson, LM, Hullett, DA, Ochoada, JM, Oberley, TD, Lang, KM. Pancreatic precursors and differentiated islet cell types from murine embryonic stem cells: an in vitro model to study islet differentiation. Diabetes 2003:52:2016-24
Crossref   Medline   1st Citation  

Keller GM. In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol 1995:7:862-9
Crossref   Medline   1st Citation  

Kubo A, Shinozaki, K, Shannon, JM, Kouskoff, V, Kennedy, M, Woo, S. Development of definitive endoderm from embryonic stem cells in culture. Development 2004:131:1651-62
Crossref   Medline   1st Citation  

Leon-Quinto T, Jones, J, Skoudy, A, Burcin, M, Soria, B. In vitro directed differentiation of mouse embryonic stem cells into insulin-producing cells. Diabetologia 2004:47:1442-51
Medline   1st Citation  

Lumelsky N, Blondel, O, Laeng, P, Velasco, I, Ravin, R, McKay, R. Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science 2001:292:1389-94
Crossref   Medline   1st Citation   2nd  

Melloul D, Marshak, S, Cerasi, E. Regulation of insulin gene transcription. Diabetologia 2002:45:309-26
Crossref   Medline   1st Citation  

Miyazaki S, Yamato, E, Miyazaki, J. Regulated expression of pdx-1 promotes in vitro differentiation of insulin-producing cells from embryonic stem cells. Diabetes 2004:53:1030-7
Crossref   Medline   1st Citation  

Mulder H, Myrsen-Axcrona, U, Gebre-Medhin, S, Ekblad, E, Sundler, F. Expression of non-classical islet hormone-like peptides during the embryonic development of the pancreas. Microsc Res Tech 1998:43:313-21
Crossref   Medline   1st Citation  

Otonkoski T, Beattie, GM, Mally, MI, Ricordi, C, Hayek, A. Nicotinamide is a potent inducer of endocrine differentiation in cultured human fetal pancreatic cells. J Clin Invest 1993:92:1459-66
Crossref   Medline   1st Citation  

Shapiro AM, Lakey, JR, Ryan, EA, Korbutt, GS, Toth, E, Warnock, GL. Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N Engl J Med 2000:343:230-8
Crossref   Medline   1st Citation  

Slack JM. Developmental biology of the pancreas. Development 1995:121:1569-80
Medline   1st Citation  

Soria B, Roche, E, Berna, G, Leon-Quinto, T, Reig, JA, Martin, F. Insulin-secreting cells derived from embryonic stem cells normalize glycemia in streptozotocin-induced diabetic mice. Diabetes 2000:49:157-62
Crossref   Medline   1st Citation   2nd   3rd  

Thorens B, Guillam, MT, Beermann, F, Burcelin, R, Jaquet, M. Transgenic reexpression of GLUT1 or GLUT2 in pancreatic beta cells rescues GLUT2-null mice from early death and restores normal glucose-stimulated insulin secretion. J Biol Chem 2000:275:23751-8
Crossref   Medline   1st Citation  

Vaca P, Berna, G, Martin, F, Soria, B. Nicotinamide induces both proliferation and differentiation of embryonic stem cells into insulin-producing cells. Transplant Proc 2003:35:2021-3
Crossref   Medline   1st Citation   2nd  

Wilson ME, Kalamaras, JA, German, MS. Expression pattern of IAPP and prohormone convertase 1/3 reveals a distinctive set of endocrine cells in the embryonic pancreas. Mech Dev 2002:115:171-6
Crossref   Medline   1st Citation  

Wu KL, Gannon, M, Peshavaria, M, Offield, MF, Henderson, E, Ray, M. Hepatocyte nuclear factor 3beta is involved in pancreatic beta-cell-specific transcription of the pdx-1 gene. Mol Cell Biol 1997:17:6002-13
Medline   1st Citation  

Zaret KS. Molecular genetics of early liver development. Annu Rev Physiol 1996:58:231-51
Crossref   Medline   1st Citation  


Received 15 June 2007/2 November 2007; accepted 22 December 2007

doi:10.1016/j.cellbi.2007.12.017


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)