Cell Biology International (2008) 32, 1064-1072 - Soon Nam Kim and others - Licochalcone A inhibits the formation and bone resorptive activity of osteoclasts

Brought to you by Portland Press Ltd.

Published on behalf of the International Federation for Cell Biology

Download to Citation Manager

Cell Biology International (2008) 32, 1064–1072 (Printed in Great Britain)

Abstract

PDF

Citing articles

Licochalcone A inhibits the formation and bone resorptive activity of osteoclasts

Soon Nam Kim^a^b, Myung Hee Kim^a^c, Yong Ki Min^a and Seong Hwan Kim^a^*

^aLaboratory of Chemical Genomics, Korea Research Institute of Chemical Technology, P.O. Box 107, Yuseong-gu, Daejeon 305-600, Republic of Korea
^bDepartment of Biology, Chungnam National University, Daejeon 305-764, Republic of Korea
^cDepartment of Biochemistry, Chungnam National University, Daejeon 305-764, Republic of Korea

Abstract

Licochalcone A on the formation and bone resorptive activity of osteoclasts up to 5μM significantly inhibited the receptor activator of nuclear factor κB (NF-κB) ligand (RANKL)-induced activity of tartrate-resistant acid phosphatase (TRAP) activity and formation of osteoclasts without any effect on cell viability. Interestingly, licochalcone A was shown to inhibit the RANKL-induced activation of extracellular signal-regulated kinase, translocation of NF-κB into nucleus and mRNA expression of Fra-2. Licochalcone A also inhibited the bone resorptive activity of mature osteoclasts and the expression of bone resorption-related genes. Inhibitory effects of licochalcone A on the formation and bone resorptive activity of mouse bone marrow macrophage-derived osteoclasts were also observed. In conclusion, licochalcone A has the potential to inhibit the formation of osteoclasts as well as the bone resorptive activity of mature osteoclasts.

Keywords: Licochalcone A, Osteoclast formation, Bone resorption, ERK, NF-κB, Fra-2.

^*Corresponding author. Tel.: +82 42 860 7687; fax: +82 42 861 0307.

1 Introduction

Bone homeostasis during remodeling is maintained by osteoclastic bone resorption and osteoblastic bone formation (Parfitt, 1987). Generally, an imbalance in bone remodeling due to increased bone resorption over bone formation leads to bone disorders such as osteoporosis (Boyle et al., 2003). Osteoclasts, multinucleated cells, are differentiated from hematopoietic cells of the monocyte/macrophage family in response to osteoclastogenic factors, especially RANKL, and mature osteoclasts have the ability to resorb mineralized bone (Teitelbaum, 2000).

Recently, beneficial effects of natural products and their derivatives on the skeleton were reported by their influencing the process of bone remodeling, in particular inhibiting bone resorption (Putnam et al., 2007). For example, soybean isoflavones, a subclass of flavonoids, mainly represented by genistein and daidzein, have received considerable attention for their potential role in preventing postmenopausal bone loss (Morabito et al., 2002), and their actions probably result in a decrease in osteoclast differentiation (Yamagishi et al., 2001; Rassi et al., 2002). During screening of natural compounds for their potential to inhibit osteoclast differentiation, we identified licochalcone A (Fig. 1) as a compound inhibiting RANKL-induced tartrate-resistant acid phosphatase (TRAP) activity in mouse monocyte/macrophage RAW264.7 cells. Licochalcone A is a flavonoid derived from licorice, which is one of the most frequently used plants in traditional Oriental medicine (Shibata, 2000). Licochalcone A has anti-inflammatory activity (Shibata et al., 1991; Kolbe et al., 2006), anti-parasitic activity (Chen et al., 1993; Mi-Ichi et al., 2005), anti-cancer activity (Rafi et al., 2000; Fu et al., 2004), anti-bacterial activity (Tsukiyama et al., 2002) and anti-browning and depigmenting activity (Fu et al., 2005), but its effect on bone metabolism has not yet been studied.

Fig. 1

Structure of licochalcone A.

Therefore, we investigated the effect of licochalcone A on the formation and bone resorptive activity of osteoclasts. To elucidate the action mechanism of licochalcone A in the processes of osteoclast differentiation and bone resorption, we also examined the effect of licochalcone A on the activation of mitogen-activated protein (MAP) kinases and transcription factors, such as NF-κB, activator protein (AP)-1 and nuclear factor of activated T cells (NFAT) c1, known to play a critical role in the induction of osteoclast-specific genes and the activation of mature osteoclasts to resorb mineralized bone (Boyle et al., 2003; Lee and Kim, 2003). The effect of licochalcone A on the expression levels of osteoclast-specific genes has also been examined.

2 Materials and methods

2.1 Cell culture and induction of multinucleated osteoclasts

Osteoclast generation was achieved using either mouse monocyte/macrophage RAW264.7 cells or the primary culture of mouse bone marrow-derived macrophages (BMMs). RAW264.7 cells have been shown to retain the capacity to differentiate into osteoclast-like cells in the presence of RANKL (Hsu et al., 1999). RAW264.7 cells were purchased from the American Type Culture Collection and maintained in Dulbecco's Modified Eagle's Medium (DMEM, HyClone, UT) supplemented with 10% fetal bovine serum (FBS, HyClone), 100U/ml of penicillin and 100mg/ml streptomycin, with a change of medium every 3days in humidified atmosphere of 5% CO2 in air at 37°C. To differentiate into osteoclasts, RAW264.7 cells were suspended in α-minimal essential medium (α-MEM, HyClone) supplemented with 10% FBS and 100ng/ml RANKL (R&D Systems Inc., MN) and plated in a 96-well plate at 1×10³ cells/well. After 3–4days, multinucleated osteoclasts were observed. To generate BMMs-derived osteoclasts, monocytes were isolated from femur and tibiae of BALB/c mice (Central Lab. Animal Inc., Korea), seeded and cultured in α-MEM with 10% FBS and 10ng/ml macrophage colony stimulating factor (M-CSF; R&D Systems) for 1day. Suspended cells at this stage were considered M-CSF-dependent BMMs and used as osteoclast precursors. Induction of their differentiation into osteoclasts was done by culturing the cells plated into a 96-well plate at 3×10⁵ cells/well in α-MEM with 10% FBS, 100ng/ml RANKL and 30ng/ml M-CSF. Multinucleated osteoclasts were observed on differentiation day 6.

2.2 Cell viability assay

RAW264.7 cells were suspended in α-MEM with 10% FBS and 100ng/ml RANKL, and plated in 96-well plates 1×10³ cells/well. After 24h, serially diluted licochalcone A (Calbiochem, Germany) was treated and incubated for 1 or 3days. Cell viability was then evaluated by Cell Counting Kit-8 (Dojindo Molecular Technologies, ML, USA) according to the manufacturer's protocol. The results are presented as mean of measured absorbance (at 450nm)±1 standard deviation, experiments being performed in triplicate. Absorbance was measured using a Wallac EnVision microplate reader (PerkinElmer, Finland).

2.3 TRAP staining and activity assay

Multinucleated osteoclasts were fixed with 10% formalin for 10min and ethanol/acetone (1:1) for 1min, and stained with Leukocyte Acid Phosphatase Kit 387-A (Sigma, MO, USA). The images of TRAP-positive multinucleated cells were taken under a microscope with DP Controller (Olympus Optical, Japan). For measuring TRAP activity, multinucleated osteoclasts were fixed with 10% formalin for 10min and 95% ethanol for 1min, followed by 100μl citrate buffer (50mM, pH 4.6) containing 10mM sodium tartrate, and 5mM p-nitrophenyl phosphate (Sigma) was added to the dried cell-containing wells. After incubation for 1h, the enzyme reaction mixtures in the wells were transferred into new plates containing an equal volume of 0.1N NaOH. Absorbance was measured at 410nm and TRAP activity was presented as a percentage of control. The experiment was performed in triplicate and differences were considered significant when p<0.01.

2.4 Isolation of total RNA

Total RNA was isolated with TRIzol reagent (Life Technologies, MD, USA) according to the manufacturer's protocol. The concentration of total RNA was calculated from the absorbance at 260 and 280nm with a BioPhotometer (Eppendorf AG, Germany).

2.5 Primer design and real-time quantitative PCR (QPCR)

Primers were chosen with an on-line primer design program (Rozen and Skaletsky, 2000; see Table 1). First-strand cDNA was synthesized with 2μg total RNA, 1μM of oligo-dT18 primer and 10units of RNase inhibitor RNasin (Promega, WI, USA) using an Omniscript RT kit (Qiagen, CA, USA), according to the manufacturer's protocol. The SYBR green-based QPCR was performed using the Stratagene Mx3000P Real-Time PCR system and Brilliant SYBR Green Master Mix (Stratagene, CA, USA) with first-strand cDNA diluted 1:50 and 20pmol of primers according to the manufacturer's protocol. The PCR reaction consisted of three segments. The first segment at 95°C for 10min was for the activation of the polymerase; the second one corresponded to 3-step cycling (40 cycles) at 94°C for 40s (denaturation), 60°C for 40s (annealing) and 72°C for 1min (extension). The third segment was for the generation of PCR product temperature dissociation curves (also called ‘melting curves’) at 95°C for 1min, 55°C for 30s and 95°C for 30s. All reactions were run in triplicate and analyzed by the 2^−ΔΔCT method (Livak and Schmittgen, 2001). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal standard gene. The statistical significance was determined by a Student's t-test with GAPDH-normalized 2^−ΔΔCT values and differences were considered significant when p<0.01.

Table 1.

Primer sequences used in this study

Target gene	Forward (5′–3′)	Reverse (5′–3′)
c-Fos	CCAGTCAAGAGCATCAGCAA	AAGTAGTGCAGCCCGGAGTA
Fra-1	AGAGCTGCAGAAGCAGAAGG	CAAGTACGGGTCCTGGAGAA
Fra-2	ATCCACGCTCACATCCCTAC	GTTTCTCTCCCTCCGGATTC
NFATc1	GGGTCAGTGTGACCGAAGAT	GGAAGTCAGAAGTGGGTGGA

TRAP	ACACAGTGATGCTGTGTGGCAACTC	CCAGAGGCTTCCACATATATGATGG
MMP-9	AGTTTGGTGTCGCGGAGCAC	TACATGAGCGCTTCCGGCAC
c-Src	CCAGGCTGAGGAGTGGTACT	CAGCTTGCGGATCTTGTAGT
ATP6v0d2	AGACCACGGACTATGGCAAC	CAGTGGGTGACACTTGGCTA
Cathepsin K	GGCCAACTCAAGAAGAAAAC	GTGCTTGCTTCCCTTCTGG

GAPDH	AACTTTGGCATTGTGGAAGG	ACACATTGGGGGTAGGAACA

2.6 Western blotting analysis

Cells were homogenized in ice-cold protein extraction buffer consisting of 50mM Tris–HCl (pH 8.0), 5mM EDTA, 150mM NaCl, 1% NP-40, 0.1% SDS, 1mM PMSF and one protease inhibitor cocktail tablet (Roche, Germany) and centrifuged at 10,000×g for 15min at 4°C. The supernatant was used as a cytoplasmic protein fraction and nuclear proteins were extracted by a NucBuster Protein Extraction kit (Novagen, Germany). The protein concentration was determined by BCA protein assay kit (Pierce, IL). Protein samples (10μg) were mixed with sample buffer (100mM Tris–HCl, 2% SDS, 1% 2-mercaptoethanol, 2% glycerol, 0.01% bromophenol blue pH 7.6), incubated at 95°C for 5min and loaded onto 10% polyacrylamide gels. Electrophoresis was run in a Mini protean 3 Cell (Bio-Rad, CA, USA). Proteins separated on the gels were transferred onto nitrocellulose membrane (Whatman, Germany) and in order to ascertain the loading amount of proteins and the efficiency of transfer, the transferred membranes were then stained with Ponceau S staining solution. The stained membrane was washed and incubated in blocking buffer (10mM Tris–HCl pH 7.5, 150mM NaCl, 0.1% Tween 20 and 3% nonfat dry milk). It was incubated for 2h at room temperature with 1:1000 diluted primary antibody (Santa Cruz Biotechnology, CA, USA). After washing with blocking buffer three times for 15min, the membrane was probed with 1:2000 diluted secondary antibody for 2h. The membrane was washed three times for 15min and developed with SuperSignal West Femto Maximum Sensitivity Substrate (Pierce, IL, USA). Chemiluminescent signal was detected with a LAS-3000 Luminescent image analyzer (Fuji Photo Film Co, Japan).

2.7 Pit formation assay

RAW264.7 cells were suspended in α-MEM with 10% FBS and 100ng/ml RANKL, and plated on BioCoat Osteologic multitest slides (BD Biosciences, MA, USA), which are coated with submicron synthetic calcium phosphate thin films, at 1×10³ cells/well. The medium was replaced with a fresh once every 3days. Multinucleated osteoclasts were observed from differentiation day 3, and at that time, licochalcone A treatment was given. After the incubation for 3days, the slides were washed with 6% sodium hypochloride solution to remove cells. The resorbed areas on the slides were observed under a microscope. M-CSF-dependent BMMs were plated and cultured in α-MEM with 10% FBS, 100ng/ml RANKL and 30ng/ml M-CSF. The medium was replaced with a fresh once every 3days. Multinucleated osteoclasts were observed on differentiation day 6, and from that time, licochalcone A was added every 3days. On differentiation day 15, the slides were washed and observed as described above. This experiment was performed in triplicate.

2.8 Lactate dehydrogenase (LDH) release assay

Cell cytotoxicity was evaluated by colorimetric assay based on the measurement of LDH activity released from the cytosol of damaged cells into the supernatant using a Cytotoxicity Detection Kit (Roche, Germany) according to the manufacturer's protocol. This experiment was performed in triplicate.

2.9 Actin rings and nucleus staining

Cells were washed with PBS twice, fixed with 10% formalin for 5min, permeabilized with 0.1% Triton X-100 in PBS for 5min and washed again with PBS. Actin rings were stained with 50μg/ml phalloidin-FITC (Sigma, MO) for 40min under the condition of light protection. After washing with PBS twice, nuclei were stained with 10μg/ml Hoechst33342 for 15min. Stained cell images were taken in a fluorescent microscope IX51 with a DP Controller. This experiment was performed in triplicate.

3 Results

In a previous study, licochalcone A was one of the compounds found to inhibit RANKL-induced TRAP activity in RAW264.7 cells (data not shown). Since licochalcone A did not show any effect on cell viability up to 5μM (Fig. 2A), the following experiments were done in the range 0–5μM. In RANKL-treated RAW264.7 cells, licochalcone A at up to 5μM significantly inhibited TRAP activity in a dose-dependent manner (Fig. 2B). licochalcone A inhibited the formation of multinucleated and TRAP-positive osteoclasts in a dose-dependent manner (Fig. 2C).

Fig. 2

Effects of licochalcone A on cell viability in the presence of RANKL (A); RANKL-induced TRAP activity (B); and RANKL-induced formation of TRAP-positive multinucleated osteoclasts (C). The effect of licochalcone A on cell viability was evaluated as described in Section 2. For osteoclast differentiation, RAW264.7 cells were plated in 96-well plates in α-MEM containing 10% FBS at the density 1×10³ cells/well with RANKL and after 24h, serially-diluted licochalcone A was treated and incubated until multinucleated osteoclasts were observed under a microscope. TRAP activity and staining were done as described in Section 2. a: p<0.01; b: p<0.001.

To elucidate the action mechanism of licochalcone A in the process of osteoclast differentiation, the effect of licochalcone A on the activation of MAP kinases and NF-κB was evaluated by Western blotting analysis. RANKL treatment dramatically induced the phosphorylation of both the c-Jun N-terminal kinase and the extracellular signal-regulated kinase (ERK), but pretreatment with licochalcone A before RANKL treatment inhibited only RANKL-induced phosphorylation of ERK (Fig. 3A). In addition, translocation of the NF-κB p65 subunit into the nucleus was strongly induced by RANKL treatment, but pretreatment with licochalcone A before RANKL treatment also inhibited its translocation by RANKL. Phosphorylation of the inhibitor of κB-α (IκBα) was induced after RANKL treatment, but pretreatment with licochalcone A before RANKL treatment inhibited its phosphorylation by RANKL (Fig. 3B).

Fig. 3

Effects of licochalcone A on activations of MAP kinases (A) and IκBα/NF-κB p65 subunit (B) in RAW 264.7 cells. Cells were plated in a 6-well plate at 2×10⁵ cells/well. After 1day incubation, licochalcone A was treated into cells 2h before RANKL treatment; protein samples were prepared 30min after RANKL treatment. Actin and histone H1 protein were used as an internal control in cytosolic and nuclear fractions, respectively.

We also looked at the effect of licochalcone A on the activations of osteoclastogenesis-related transcription factors AP-1 and NFATc1. When evaluated by real-time QPCR, all the genes studied were significantly induced by RANKL treatment, but only the induction of Fra-2 gene was significantly inhibited by pre-treatment with licochalcone A before RANKL treatment in a dose-dependent manner (Table 2).

Table 2.

The effect of licochalcone A on RANKL-induced mRNA expression levels of AP-1 family and NFATc1 in RAW264.7 cells

	c-Fos	Fra-1	Fra-2	NFATc1
Without RANKL	1.00 ± 0.01	1.00 ± 0.07	1.00 ± 0.06	1.00 ± 0.03
With RANKL	2.46 ± 0.45^a	1.97 ± 0.06^b	9.57 ± 0.27^b	10.19 ± 0.52^b
Licochalcone A (1 μM) with RANKL	2.78 ± 0.09	1.83 ± 0.07	7.61 ± 0.44^c	9.36 ± 0.32
Licochalcone A (5 μM) with RANKL	3.22 ± 0.07	2.27 ± 0.171	6.91 ± 0.55^c	8.28 ± 0.87

The effect of licochalcone A on bone resorptive activity of mature osteoclasts was also evaluated. RANKL-induced mature osteoclasts resorbed bone matrices, but the whole area of resorption pit excavations by mature osteoclasts was dramatically inhibited by treatment with licochalcone A in a dose-dependent manner (upper images in Fig. 4). To determine whether the inhibitory activity of licochalcone A in bone resorption could result from its potential to trigger the apoptosis (or cell death) of mature osteoclasts, we also evaluated the effect of licochalcone A on the appearance of apoptotic nuclear condensation, the disruption of actin rings and the release of LDH, which can be used as index of cell death. Interestingly, while licochalcone A inhibited bone resorptive activity of mature osteoclasts, there was neither apoptotic nuclear condensation nor disruption of the actin rings (bottom images in Fig. 4). Release of LDH by licochalcone A was not observed (data not shown). These results suggested the possibility that the inhibitory effect of licochalcone A on bone resorptive activity of mature osteoclasts results from its activity in suppressing the expression of genes required for functional osteoclasts, not triggering apoptosis (or cell death) of mature osteoclasts.

Fig. 4

Effect of licochalcone A on bone resorptive activity of mature osteoclasts derived in RAW264.7 cells. The bone resorptive activity was measured by using BioCoat Osteologic multitest slides. After the formation of multinucleated osteoclasts, cells were incubated with fresh medium containing RANKL and licochalcone A for 3days, and then cells on the slides were removed and the resorbed areas on the slides were observed under a microscope (upper image, magnification ×100). At the same time, the actin rings and nuclei of multinucleated osteoclasts, which were cultured in 96-well plates, were stained with phalloidin-FITC and Hoechst33342, respectively (bottom image, magnification ×200).

Therefore, the effect of licochalcone A on the mRNA expression levels of genes required for functional osteoclasts such as TRAP, matrix metalloproteinase-9 (MMP-9), c-Src, v-ATPase V0 subunit d2 (ATP6v0d2) and cathepsin K was further evaluated by real-time QPCR. When normalized with GAPDH expression levels as described in Section 2, all genes evaluated were dramatically induced by RANKL at their transcript levels, but pretreatment with licochalcone A 2h before RANKL treatment significantly inhibited these inductions in a dose-dependent manner (Table 3A). Additionally, when multinucleated osteoclasts induced by RANKL treatment for 3days were incubated with licochalcone A for 1day, licochalcone A at 5μM significantly inhibited mRNA expression levels of both MMP-9 and ATP6v0d2 in multinucleated osteoclasts.

Table 3.

The effect of licochalcone A on RANKL-induced mRNA expression levels of osteoclast-specific genes in RAW264.7 cells

		TRAP	MMP-9	c-Src	ATP6v0d2	Cathepsin K
(A)	Without RANKL	1.01 ± 0.13	1.04 ± 0.38	1.03 ± 0.30	1.00 ± 0.12	1.00 ± 0.08
	With RANKL	152.27 ± 4.95^a	835.73 ± 28.30^a	94.23 ± 5.22^a	74.05 ± 2.22^a	63.05 ± 3.71^a
	Licochalcone A (1 μM) with RANKL	167.54 ± 11.49	639.29 ± 23.65^c	57.44 ± 5.21^c	56.45 ± 0.72^c	50.09 ± 2.27^b
	Licochalcone A (5 μM) with RANKL	118.51 ± 7.97^b	445.17 ± 27.76^c	64.50 ± 3.43^b	29.13 ± 0.48^c	15.71 ± 1.18^c

(B)	Without RANKL	1.00 ± 0.05	1.00 ± 0.07	1.00 ± 0.05	1.00 ± 0.06	1.00 ± 0.07
	With RANKL	68.82 ± 4.09^a	103.79 ± 4.37^a	7.72 ± 0.83^a	15.07 ± 0.22^a	138.51 ± 16.77^a
	Licochalcone A (1 μM) with RANKL	67.54 ± 14.03	103.06 ± 3.69	10.01 ± 0.28	13.12 ± 0.29^c	123.20 ± 5.98
	Licochalcone A (5 μM) with RANKL	68.94 ± 3.11	63.32 ± 3.13^c	5.45 ± 0.58	13.66 ± 0.07^b	112.50 ± 13.04

The effect of licochalcone A on the osteoclastogenesis of BMMs was also evaluated. Licochalcone A did not decrease the viability of BMMs (data not shown), but consistent with results in RAW264.7 cells, it inhibited the formation of osteoclast (Fig. 5A) and the TRAP activity (Fig. 5B) that were induced by both stimulators, RANKL and M-CSF. The treatment of both stimulators into BMMs induced phosphorylation of ERK, but pre-treatment of licochalcone A inhibited the induction of ERK phosphorylation (Fig. 5C). In addition, both stimulators also induced the translocation of NF-κB p65, but this was inhibited by pre-treatment of licochalcone A. The bone resorptive activity of BMMs-derived mature osteoclasts was dose-dependently inhibited by licochalcone A (Fig. 5D).

Fig. 5

Effects of licochalcone A on RANKL/M-CSF-induced formation of multinucleated osteoclasts (A); TRAP activity (B); activations of ERK and translocation of NF-κB p65 subunit (C); and bone resorptive activity of mature osteoclasts (D) derived in BMMs. The generation of multinucleated osteoclasts in BMMs and the bone resorptive activity assay were achieved as described in Section 2. For Western blotting analysis, M-CSF-dependent BMMs were plated in a 60-mm dish at 4×10⁶ cells. After 1day incubation, licochalcone A was treated into cells 2h before treatment of both RANKL and M-CSF; protein samples were prepared 1h after treatment of both RANKL and M-CSF. ^ap<0.01; ^bp<0.001.

4 Discussion

Osteoclastogenesis takes place through multiple steps such as differentiation, fusion and activation of mature osteoclasts by the factors such as RANKL. The binding of RANKL to its receptor RANK, which is a member of tumor necrosis factor receptor (TNFR) superfamily, recruits adaptor molecules such as TNFR-associated factor 6 (TRAF6), induces its trimerization and subsequently leads to the activation of MAP kinase families and transcription factors such as NF-κB (Lee et al., 2002; Lee and Kim, 2003). In differentiated osteoclasts, ERK and NF-κB play an especially important role in the survival and resorption activity of osteoclast (Miyazaki et al., 2000). However, considering that several natural compounds, including tanshinone IIA, coumestrol and curcumin, inhibit osteoclastogenesis by preventing the RANKL-induced activations of ERK and/or NF-κB (Bharti et al., 2004; Kanno et al., 2004; Kim et al., 2004), both signaling molecules may play an important role in the process of osteoclast differentiation. In this study, when licochalcone A significantly inhibited the RANKL-induced formation of osteoclasts, it inhibited the RANKL-induced activations of ERK and NF-κB in both RAW264.7 cells and BMMs.

The binding of RANKL to RANK can also trigger activation of other transcription factors, such as AP-1 and NFATc1. RANKL activates AP-1 partly through an induction of its critical component, c-Fos (Takayanagi et al., 2002; Wagner and Eferl, 2005). In mice lacking the c-Fos gene, severe osteopetrosis due to a complete block of osteoclast differentiation has been observed (Johnson et al., 1992; Wang et al., 1992). Another member of the Fos family, Fra-1, is a transcriptional target of c-Fos during osteoclast differentiation (Matsuo et al., 2000) and can compensate for the loss of c-Fos (Eferl et al., 2004). Although the compensatory ability of Fra-2 was relatively weaker than that of Fra-1, Fra-2 also rescued the blockade of differentiation in c-Fos-deficient osteoclast precursor cells (Matsuo et al., 2000). In addition, considering that NF-κB and c-Fos were recruited to the NFATc1 gene promoter immediately and 24h after RANKL stimulation, respectively (Asagiri et al., 2005), the NFATc1gene may be a common target of both of the essential transcription factors NF-κB and AP-1 during osteoclastogenesis. RANKL treatment induced the expression of those genes, but licochalcone A significantly inhibited RANKL-induced Fra-2 gene expression. Considering that the expression of Fra-2 was increased by the sustained stimulation of ERK in osteoclasts (Miyazaki et al., 2000), the inhibitory effect of licochalcone A on the expression of Fra-2 in the process of osteoclast differentiation could result from its potential to inhibit the RANKL-induced activation of ERK.

Mature osteoclasts are characterized by multinuclearity, an actin ring structure and acidic cell condition; a major function of these cells is to resorb mineralized bone surface. The bone resorptive activity of mature osteoclasts can be inhibited by disrupting the actin ring, triggering the apoptosis of mature osteoclasts and/or inhibiting expression/activity of molecules required for functional osteoclasts. We have shown that licochalcone A inhibits the bone resorptive activity of mature osteoclasts by attenuating the RANKL-induced osteoclast-specific genes (TRAP, MMP-9, c-Src, ATP6v0d2 and cathepsin K) required for osteoclastic differentiation, osteoclast fusion and/or bone resorption (Soriano et al., 1991; Lowe et al., 1993; Halleen et al., 1999; Ishikawa et al., 2001; Ishibashi et al., 2006; Lee et al., 2006), but not with the appearance of apoptotic nuclear condensation, the disruption of actin rings and the release of LDH. Licochalcone A significantly attenuated the induction of all genes by RANKL in the process of osteoclast formation and also significantly inhibited the induction of mRNA expression of both MMP-9 and ATP6v0d2 in mature osteoclasts. TRAP is highly expressed in osteoclasts and widely used as a phenotypic marker of osteoclasts. A binuclear iron atom in the active center of TRAP allows the formation of reactive oxygen species, especially highly destructive hydroxyl radicals; in the presence of H2O2, collagen and other proteins were cleaved in to small peptide fragments by TRAP, suggesting that it has a role in the degradation of extracellular proteins (Halleen et al., 1999, 2003). MMP-9 is localized exclusively in osteoclasts of the bone tissues (Okada et al., 1995) and its involvement in osteoclastic bone resorption process by facilitating migration of osteoclasts has recently been suggested (Ishibashi et al., 2006). In addition, it has been suggested that c-Src is required for osteoclastic bone resorption, since the c-Src gene knockout mouse contains abundant osteoclasts while being incapable of bone resorption (Soriano et al., 1991; Lowe et al., 1993). The function of ATP6v0d2 has also been studied in knockout mice. ATP6v0d2 is highly upregulated during osteoclast differentiation and most abundant in mature osteoclasts, but its inactivation results in a markedly increased bone mass due to defective osteoclasts; this suggests that it is required for efficient pre-osteoclast fusion (Lee et al., 2006). Cathepsin K, the most abundant and specific cysteine protease found in osteoclasts, reportedly plays important roles in bone resorption as well as in differentiation of osteoclasts (Ishikawa et al., 2001). Therefore, our results suggest that the inhibitory effect of licochalcone A on bone resorption results from its potential to inhibit the induction of bone resorption-related osteoclastic gene expression by RANKL.

In this study, licochalcone A has been shown to have dual activity: it inhibited the formation of osteoclasts and the bone resorptive activity of mature osteoclasts. Momordin I has been shown to suppress osteoclastogenesis through inhibition of NF-κB and AP-1; it also reduces osteoclast activity and survival (Hwang et al., 2005). The similarity between licochalcone A and momordin I is that they inhibit osteoclastogenesis via inhibition of NF-κB and AP-1 and reduce the bone resorptive activity of mature osteoclasts. However, there are two differences between them: (1) licochalcone A, but not momordin I, inhibits RANKL-induced activation of MAP kinase; and (2) momordin I, but not licochalcone A, stimulates actin ring disruption. This suggests that the inhibitory effect of momordin I on the bone resorptive activity of mature osteoclasts may result from its potential to stimulate the apoptosis of osteoclasts.

In conclusion, we first demonstrated that licochalcone A has the potential to inhibit the formation of osteoclasts via preventing activation of the ERK and NF-κB signaling pathways that might consequently affect activation of AP-1 components such as Fra-2; and second, that it may also suppress the bone resorptive activity of mature osteoclasts by regulating the expression of bone resorption-related genes in part. Further studies are needed to determine its precise mechanism of action and biological efficacy in both ex vivo and in vivo models.

Acknowledgments

This work was supported by grants to S.N.K., Y.K.M. and S.H.K. from the Korea Science and Engineering Foundation (KOSEF), funded by the Korea government (MOST) No. M10526020001-07N2602-00110.

References

Asagiri M, Sato, K, Usami, T, Ochi, S, Nishina, H, Yoshida, H. Auto amplification of NFATc1 expression determines its essential role in bone homeostasis. J Exp Med 2005:202:1261-9
Crossref Medline 1st Citation

Bharti AC, Takada, Y, Aggarwal, BB. Curcumin (diferuloylmethane) inhibits receptor activator of NF-κB ligand-induced NF-κB activation in osteoclast precursors and suppresses osteoclastogenesis. J Immunol 2004:172:5940-7
Medline 1st Citation

Boyle WJ, Simonet, WS, Lacey, DL. Osteoclast differentiation and activation. Nature 2003:423:337-42
Crossref Medline 1st Citation 2nd

Chen M, Christensen, SB, Blom, J, Lemmich, E, Nadelmann, L, Fich, K. Licochalcone A, a novel antiparasitic agent with potent activity against human pathogenic protozoan species of Leishmania. Antimicrob Agents Chemother 1993:37:2550-6
Medline 1st Citation

Eferl R, Hoebertz, A, Schilling, AF, Rath, M, Karreth, F, Kenner, L. The Fos-related antigen Fra-1 is an activator of bone matrix formation. EMBO J 2004:23:2789-99
Crossref Medline 1st Citation

Fu B, Li, H, Wang, X, Lee, FS, Cui, S. Isolation and identification of flavonoids in licorice and a study of their inhibitory effects on tyrosinase. J Agric Food Chem 2005:53:7408-14
Crossref Medline 1st Citation

Fu Y, Hsieh, TC, Guo, J, Kunicki, J, Lee, MY, Darzynkiewicz, Z. Licochalcone-A, a novel flavonoid isolated from licorice root (Glycyrrhiza glabra), causes G2 and late-G1 arrests in androgen-independent PC-3 prostate cancer cells. Biochem Biophys Res Commun 2004:322:263-70
Crossref Medline 1st Citation

Halleen JM, Raisanen, SR, Alatalo, SL, Vaananen, HK. Potential function for the ROS-generating activity of TRACP. J Bone Miner Res 2003:18:1908-11
Crossref Medline 1st Citation

Halleen JM, Raisanen, S, Salo, JJ, Reddy, SV, Roodman, GD, Hentunen, TA. Intracellular fragmentation of bone resorption products by reactive oxygen species generated by osteoclastic tartrate-resistant acid phosphatase. J Biol Chem 1999:274:22907-10
Crossref Medline 1st Citation 2nd

Hsu H, Lacey, DL, Dunstan, CR, Solovyev, I, Colombero, A, Timms, E. Tumor necrosis factor receptor family member RANK mediates osteoclast differentiation and activation induced by osteoprotegerin ligand. Proc Natl Acad Sci USA 1999:96:3540-5
Crossref Medline 1st Citation

Hwang YH, Lee, JW, Hahm, ER, Jung, KC, Lee, JH, Park, CH. Momordin I, an inhibitor of AP-1, suppressed osteoclastogenesis through inhibition of NF-κB and AP-1 and also reduced osteoclast activity and survival. Biochem Biophys Res Commun 2005:337:815-23
Medline 1st Citation

Ishibashi O, Niwa, S, Kadoyama, K, Inui, T. MMP-9 antisense oligodeoxynucleotide exerts an inhibitory effect on osteoclastic bone resorption by suppressing cell migration. Life Sci 2006:79:1657-60
Crossref Medline 1st Citation 2nd

Ishikawa T, Kamiyama, M, Tani-Ishii, N, Suzuki, H, Ichikawa, Y, Hamaguchi, Y. Inhibition of osteoclast differentiation and bone resorption by cathepsin K antisense oligonucleotides. Mol Carcinog 2001:32:84-91
Crossref Medline 1st Citation 2nd

Johnson RS, Spiegelman, BM, Papaioannou, V. Pleiotropic effects of a null mutation in the c-fos proto-oncogene. Cell 1992:71:577-86
Crossref Medline 1st Citation

Kanno S, Hirano, S, Kayama, F. Effects of the phytoestrogen coumestrol on RANK-ligand-induced differentiation of osteoclasts. Toxicology 2004:203:211-20
Crossref Medline 1st Citation

Kim HH, Kim, JH, Kwak, HB, Huang, H, Han, SH, Ha, H. Inhibition of osteoclast differentiation and bone resorption by tanshinone IIA isolated from Salvia miltiorrhiza Bunge. Biochem Pharmacol 2004:67:1647-56
Crossref Medline 1st Citation

Kolbe L, Immeyer, J, Batzer, J, Wensorra, U, Dieck, KT, Mundt, C. Anti-inflammatory efficacy of Licochalcone A: correlation of clinical potency and in vitro effects. Arch Dermatol Res 2006:298:23-30
Crossref Medline 1st Citation

Lee ZH, Kim, HH. Signal transduction by receptor activator of nuclear factor kappa B in osteoclasts. Biochem Biophys Res Commun 2003:305:211-4
Crossref Medline 1st Citation 2nd

Lee SE, Woo, KM, Kim, SY, Kim, HM, Kwack, K, Lee, ZH. The phosphatidylinositol 3-kinase, p38, and extracellular signal-regulated kinase pathways are involved in osteoclast differentiation. Bone 2002:30:71-7
Medline 1st Citation

Lee SH, Rho, J, Jeong, D, Sul, JY, Kim, T, Kim, N. v-ATPase V0 subunit d2-deficient mice exhibit impaired osteoclast fusion and increased bone formation. Nat Med 2006:12:1403-9
Crossref Medline 1st Citation 2nd

Livak KJ, Schmittgen, TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2^−ΔΔCT method. Methods 2001:25:402-8
Crossref Medline 1st Citation

Lowe C, Yoneda, T, Boyce, BF, Chen, H, Mundy, GR, Soriano, P. Osteopetrosis in src-deficient mice is due to an autonomous defect of osteoclasts. Proc Natl Acad Sci USA 1993:90:4485-9
Crossref Medline 1st Citation 2nd

Matsuo K, Owens, JM, Tonko, M, Elliott, C, Chambers, TJ, Wagner, EF. Fosl1 is a transcriptional target of c-Fos during osteoclast differentiation. Nat Genet 2000:24:184-7
Crossref Medline 1st Citation 2nd

Mi-Ichi F, Miyadera, H, Kobayashi, T, Takamiya, S, Waki, S, Iwata, S. Parasite mitochondria as a target of chemotherapy: inhibitory effect of licochalcone A on the Plasmodium falciparum respiratory chain. Ann NY Acad Sci 2005:1056:46-54
Crossref Medline 1st Citation

Miyazaki T, Katagiri, H, Kanegae, Y, Takayanagi, H, Sawada, Y, Yamamoto, A. Reciprocal role of ERK and NF-kappaB pathways in survival and activation of osteoclasts. J Cell Biol 2000:148:333-42
Crossref Medline 1st Citation 2nd

Morabito N, Crisafulli, A, Vergara, C, Gaudio, A, Lasco, A, Frisina, N. Effects of genistein and hormone-replacement therapy on bone loss in early postmenopausal women: a randomized double-blind placebo-controlled study. J Bone Miner Res 2002:17:1904-12
Crossref Medline 1st Citation

Okada Y, Naka, K, Kawamura, K, Matsumoto, T, Nakanishi, I, Fujimoto, N. Localization of matrix metalloproteinase 9 (92-kilodalton gelatinase/type IV collagenase=gelatinase B) in osteoclasts: implications for bone resorption. Lab Invest 1995:72:311-22
Medline 1st Citation

Parfitt AM. Bone remodeling and bone loss: understanding the pathophysiology of osteoporosis. Clin Obstet Gynecol 1987:30:789-811
Crossref Medline 1st Citation

Putnam SE, Scutt, AM, Bicknell, K, Priestley, CM, Williamson, EM. Natural products as alternative treatments for metabolic bone disorders and for maintenance of bone health. Phytother Res 2007:21:99-112
Crossref Medline 1st Citation

Rafi MM, Rosen, RT, Vassil, A, Ho, CT, Zhang, H, Ghai, G. Modulation of bcl-2 and cytotoxicity by licochalcone-A, a novel estrogenic flavonoid. Anticancer Res 2000:20:2653-8
Medline 1st Citation

Rassi CM, Lieberherr, M, Chaumaz, G, Pointillart, A, Cournot, G. Down-regulation of osteoclast differentiation by daidzein via caspase 3. J Bone Miner Res 2002:17:630-8
Crossref Medline 1st Citation

Rozen S, Skaletsky, HJ. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 2000:132:365-86
Medline 1st Citation

Shibata S. A drug over the millennia: pharmacognosy, chemistry, and pharmacology of licorice. Yakugaku Zasshi 2000:120:849-62
Medline 1st Citation

Shibata S, Inoue, H, Iwata, S, Ma, RD, Yu, LJ, Ueyama, H. Inhibitory effects of licochalcone A isolated from Glycyrrhiza inflata root on inflammatory ear edema and tumour promotion in mice. Planta Med 1991:57:221-4
Crossref Medline 1st Citation

Soriano P, Montgomery, C, Geske, R, Bradley, A. Targeted disruption of the c-src proto-oncogene leads to osteopetrosis in mice. Cell 1991:64:693-702
Crossref Medline 1st Citation 2nd

Takayanagi H, Kim, S, Koga, T, Nishina, H, Isshiki, M, Yoshida, H. Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclasts. Dev Cell 2002:3:889-901
Crossref Medline 1st Citation

Teitelbaum SL. Bone resorption by osteoclasts. Science 2000:289:1504-8
Crossref Medline 1st Citation

Tsukiyama R, Katsura, H, Tokuriki, N, Kobayashi, M. Antibacterial activity of licochalcone A against spore-forming bacteria. Antimicrob Agents Chemother 2002:46:1226-30
Crossref Medline 1st Citation

Wagner EF, Eferl, R. Fos/AP-1 proteins in bone and the immune system. Immunol Rev 2005:208:126-40
Crossref Medline 1st Citation

Wang ZQ, Ovitt, C, Grigoriadis, AE, Mohle-Steinlein, U, Ruther, U, Wagner, EF. Bone and haematopoietic defects in mice lacking c-fos. Nature 1992:360:741-5
Crossref Medline 1st Citation

Yamagishi T, Otsuka, E, Hagiwara, H. Reciprocal control of expression of mRNAs for osteoclast differentiation factor and OPG in osteogenic stromal cells by genistein: evidence for the involvement of topoisomerase II in osteoclastogenesis. Endocrinology 2001:142:3632-7
Crossref Medline 1st Citation

Received 26 November 2007/10 March 2008; accepted 25 April 2008

doi:10.1016/j.cellbi.2008.04.017

CBI home

Browse archive

ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)