Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2008) 32, 1108–1115 (Printed in Great Britain)
Inhibition of lipopolysaccharide-mediated rat alveolar macrophage activation in vitro by antiflammin-1
Jianzhong Han, Chen Li, Huijun Liu, Dandan Fen, Wanxiang Hu, Yong Liu, Chaxiang Guan and Zi‑qiang Luo*
Department of Physiology, Xiang-Ya Medical School, Central South University, 110 Xiangya Road, Changsha, PR China


Abstract

Antiflammin-1 (AF-1) is a synthetic nonapeptide with a similar sequence to the conserved sequence of CC10 secreted by lung Clara cells. Studies suggest that it is potent inhibitor of inflammation. We investigated the effects and possible mechanisms of AF-1 on LPS-induced alveolar macrophage (AM) activation in vitro. AMs harvested from the BALF of Sprague-Dawley (SD) rat were treated with various concentrations of AF-1 both simultaneously and after LPS stimulation. The concentrations of the cytokines IL-1β, IL-6, and IL-10 in the supernatant were detected by an enzyme-linked immunosorbent assay. The mRNA expression levels of these cytokines in AMs were analyzed using quantitative RT-PCR. To investigate more fully the possible mechanisms by which AF-1 modulates the expression of cytokines, cells were pretreated with anti-IL-10 antibody. Toll-like receptor-4 (TLR-4) expression on the cell surface was also detected using flow cytometry. The results showed that AF-1 suppressed mRNA expression and protein production of IL-1β and IL-6, while it promoted IL-10 expression in LPS-stimulated AMs, in a dose-dependent manner. The inhibitory effects of AF-1 on IL-1β were significantly decreased when endogenous production of IL-10 was blocked. AF-1 also showed an effect on downregulated TLR-4 expression in LPS-stimulated AMs. The data show for the first time that AF-1 modulates the AM response to LPS by regulating TLR-4 expression and upregulating IL-10 secretion, which could be another important mechanism in the AF-1 inhibiting effect on inflammation.


Keywords: Antiflammin-1, Cytokine, Lipopolysaccharides, Macrophages, Alveolar, Toll-like receptor-4.

*Corresponding author. Tel.: +86 731 2355051; fax: +86 731 2355056.


1 Introduction

Regulation of the pulmonary host defense mechanism is crucial for protection of the lung without pathological consequences. This is exemplified in the normal lung by the induction of both pro-inflammatory cytokines such as tumor necrosis factor-α (TNF-α), interleukin (IL)-1, IL-6, IL-8 and IL-12, and the anti-inflammatory cytokine IL-10 by bacterial lipopolysaccharide (LPS) (Lloret and Moreno, 1992; Losa et al., 1999). LPS is an endotoxin from the outer membrane of gram-negative organisms and a primary trigger of innate immunity and acute inflammation (Ulevitch and Tobias, 1999). In many cell types, LPS induces inflammation by binding to soluble LPS-binding proteins, which then facilitates binding to membrane-associated accessory proteins, particularly membrane CD14 (mCD14) and MD-2 and at least one signaling-competent coreceptor where the mammalian toll-like receptor-4 (TLR-4) has been implicated (Poltorak et al., 1998). This LPS receptor complex then triggers activation of myeloid differentiation protein (MyD88), MyD88-associated protein Mal, TNF-receptor-associated factor-6 (TRAF-6) and IL-1-receptor-associated kinase (IRAK), and finally activates transcriptional factors NF-κB, MAPK and IRF3 (Carter et al., 1999; Fitzgerald et al., 2001; Bozinovski et al., 2002, 2004). These signal transduction intermediary molecules in turn upregulate inflammatory mediator and chemokine synthesis and also trigger preformed mediator release. There are also molecules negatively regulating these process, such as macrophage migration inhibitory factor (MIF) (Roger et al., 2001) and MyD88 short (MyD88s) (Janssens et al., 2002), suppressor of cytokine signaling-1 (SCOS-1) (Nakagawa et al., 2002).

Alveolar macrophages (AMs) are the most abundant cells in the alveoli, distal airspaces and conducting airways. They are the first line of defense against infectious agents and other immunologic insults, which constitute 85% of the cells obtained by bronchoalveolar lavage (Grattendick et al., 2002). Normal resting-state AMs have an augmented ability to respond nonspecifically to foreign antigens through phagocytosis but a limited ability to initiate specific immune responses. However, monocytes recently recruited into the alveolar space have an enhanced ability to initiate an acquired immune response (Spiteri et al., 1992; Kradin et al., 2000). This indicates that, under the normal condition, the components in the alveolar milieu play important roles in limiting AM activation. Within these components, CC10 is one that is highlighted at present.

Clara cell 10-kDa protein/uteroglobin/Clara cell secreted protein (CC10, UG, CCSP) have been implicated in the regulation of inflammation processes. CC10 is a homodimeric protein produced by Clara cells, which are nonciliated bronchiolar cells in the lung (Singh and Katyal, 2000). CC10 mRNA is also expressed to a lesser extent in the prostate, thyroid, mammary and pituitary glands as well as in the uterus during pregnancy (Peri et al., 1993, 1995). In the lung, CC10 is one of the most abundant soluble proteins in the extracellular lining fluid of airways (Singh et al., 1990). In in vitro studies, CC10 inhibited the secretory phospholipase A2 enzyme and inhibited chemotaxis of macrophages and neutrophils in uterine tissue (Mantile et al., 1993). Likewise, in vitro studies with airway epithelial cells have suggested that CC10 may modulate the activity of various cytokines, including interferon-γ (IFN-γ) and TNF-α (Dierynck et al., 1996).

In vivo, CCSP-deficient mice generated by gene targeting showed increased inflammatory response after lung injury and viral infection (Ikegami et al., 1999). After hyperoxic exposure, CCSP (−/−) mice had reduced survival times and increased pro-inflammatory cytokine production in the lungs (Girod et al., 1996). They also had increased sensitivity to lung injury induced by ozone (Plopper et al., 2006). CC10 also plays a role in immune modulation that follows pulmonary infection. After administration of adenovirus, inflammation, neutrophil migration and pro-inflammatory cytokine production were increased in the lungs of CCSP (−/−) mice (Wang et al., 2003; Plopper et al., 2006). Collectively, these studies suggest a role for CC10 as an important constitutive protein that modulates lung host defense and inflammatory responses after lung injury.

AF-1 is a synthetic nonapeptide with similar sequence to the conserved sequence of CC10 (residues 39–47, MQMKKVLDS). This peptide corresponds to the nine C-terminal amino acids of α-helix 3 of CC10 (Chowdhury et al., 2002). It has been implicated in a broad range of cellular functions, including potent PLA2 inhibition, anti-inflammatory activities and regulating the expression of adhesion molecules on human leukocytes (Miele et al., 1990; Miele, 2000; Zouki et al., 2000). Study in our lab has showed that AF-1 intervention can reduce lung injury and inflammation induced by LPS in naphthalene resulted Clara cell-depleted mice; it also elevated IL-10 mRNA expression in the lung homogenates (data not shown). Although studies report that it shares several properties of CC10, the effect of AF-1 on cytokine expression from activated macrophages is still unclear and the mechanisms by which it modulates these cellular responses need further study.

To gain further understanding of the role of AF-1 in its anti-inflammation function, we investigated the effect of AF-1 on the regulation of cytokines expression in LPS-activated AMs, and demonstrated for the first time that AF-1 exhibits a differential effect on pro-inflammatory and anti-inflammatory cytokines expression in LPS-activated AMs. Its anti-inflammation effect is, at least in part, via upregulating IL-10 secretion and down-regulating TLR-4 expression.

2 Materials and methods

2.1 Reagents

AF-1 (MQMKKVLDS) was synthesized by Huamei Biotechnic Co. (China) with a purity of >90% (HPLC). It was stored in sealed glass vials and desiccated at −20°C until use. AF-1 was dissolved in Tris–HCl 10mM pH 8.0 buffer to prepare a stock solution at 10μg/ml. AF-1 was never stored in solution.

Anti-mouse toll-like receptor-4 (TLR-4) mAb for flow cytometry and anti-mouse IL-10 mAb were purchased from Boster (China). Escherichia coli 055:B5 LPS was obtained from Sigma; IL-1β, IL-6 and IL-10 ELISA kits from R&D Systems; MMLV reverse transcriptase RNase inhibitor from Promega; cDNA Probe Synthesis from Takara, dalian; Biotin-16-dUTP from Roche; and sheared salmon sperm DNA from Invitrogen. All other reagents were of analytical grade.

2.2 AM isolation and culture

Bronchoalveolar lavage (BAL) was performed to obtain AM in culture for in vitro studies. Sprague-Dawley (SD) rats (from the Experimental Animal Center of Central South University) were euthanized by intraperitoneal (ip) injection of Na pentobarbital (50mg/kg) followed by exsanguinations via the abdominal aorta. The trachea was then exposed and intubated using a 2mm outside diameter polyethylene catheter. The bronchoalveolar lavage (BAL) was performed by instilling Dulbecco's phosphate-buffered saline (PBS) containing 5mM EDTA in 1ml aliquots. Each time 5ml of PBS was instilled per rat, approximately 4.5ml of lavage fluid retrieved. After five washes, the bronchoalveolar lavage (BAL) cells were pooled together and centrifuged at 400g for 10min at 4°C; hypotonic saline (0.2%) was added to the pellet to lyse the red blood cells. After three washes, the cells were re-suspended on a 100mm plate in RPMI 1640 medium (Gibco), penicillin (100U/ml), streptomycin (100U/ml) for 2h. Cells that adhered to the plate were collected. The purity of the AMs was determined according to nonspecific esterase staining. Viability always exceeded 95% according to trypan blue exclusion.

For culture supernatant collection and isolation of RNA, cells were plated in a 100-mm tissue culture dish with a ratio of 106cells/ml RPMI 1640 for 2h, and then graded concentrations of AF-1 (0.1–10μg/l) were added either prior to or simultaneously or after LPS (0.5μg/ml) stimulation. Anti-IL-10 mAb (5μg/ml) was added in advance when needed. The cells were then incubated at 37°C under an atmosphere of 5% CO2 in air, for times indicated below. After incubation, cell culture supernatants were harvested and stored at −70°C for cytokine protein measurement. Cells were washed and lysed for RNA isolation applied for real-time PCR. In separate experiments, adherent AMs were released by 5mM EDTA for 10min and collected for detection of TLR-4 expression on the surface of macrophages by flow cytometric analysis.

2.3 RNA isolation and detection with quantitive real-time PCR

Total cellular RNA was extracted by Trizol (Qiagen Inc.). The yield and purity of the RNA were measured spectrophotometrically by absorption at 260–280nm. cDNA was synthesized from 1.5μg of total RNA by reverse transcription using the MMLV reverse transcriptase enzyme (Promaga). Primers for IL-10, IL-6, IL-1β and GAPDH were – GAPDH: sense 5′AAGAAGGTGGTGAAGCAGGC3′ and antisense 5′CCACCACCCTGTTGCTGTA3′ (203bp); IL-1β sense: 5′CTGAAAGCTCTCCACCTC3′ and antisense 5′GGTGCTGATGTACCAGTTGG3′ (297bp); IL-6 sense 5′AGTTGTGCAATGGCAATTCTG3′ and antisense 5′AGGACTCTGGCTTTGTCTTTC3′ (223bp); and IL-10 sense 5′CCCTGGGTGAGAAGCTGAAGA3′ and antisense 5′CATTCATGGCCT TGTAGACACC3′ (147bp); designed using the default settings of the manufacturer for the Primer 5.0 program. IL-1β, IL-6, IL-10 mRNA levels were quantitatively determined on an ABI Prism 7000 sequence detection system (Applied Biosystems) using a SYBR-green detector. The relative mRNA of each target gene was normalized to a housekeeping gene, GAPDH.

2.4 Enzyme-linked immunosorbent assay (ELISA) for cytokine proteins

To determine the production of inflammatory mediators in activated macrophages, alveolar macrophages isolated and purified from rat were stimulated with LPS as described above; culture supernatants were collected and assayed for IL-1β, IL-6 and IL-10 using ELISA kits according to the manufacturer's instructions (R&D Systems, USA). Briefly, the 96-well plates were coated overnight at 4°C with the primary antibody. The wells were washed three times and incubated for 1h with blocking solution and then washed four times with PBS containing 0.05% Tween 20. Samples and diluted standards (Genzyme, Cambridge, MA, USA) were added to the plate at 50μl/well and incubated at 4°C overnight. After washing, the biotinylated anti-mouse secondary antibody was added. After 2h incubation at room temperature, the wells were washed and avidin-conjugated horseradish peroxidase (HRP) was added at room temperature for 1h. The substrate solution was added and the plates were left at room temperature for 30–40min. The colored product was read at 450nm. The samples were assayed in duplicates, and each experiment was repeated at least three times.

2.5 Flow cytometric analysis for toll-like receptor-4

AMs cultured for detecting TLR-4 expression were treated with different concentrations of AF-1 with or without being LPS-stimulated. Cells were then suspended in 0.5% BSA/PBS and 1μl of ‘FcR block’ (Pharmingen) was added for 5min to block nonspecific binding; cells were stained with optimal dilutions of monoclonal anti-mouse TLR-4 (1:100) and incubated for 20–30min at 4°C and washed with cold PBS three times. Following the addition of the FITC conjugate second antibody, cells were incubated for 20–30min at 4°C in the dark, washed with cold PBS, fixed with 0.2ml of 1% paraformaldehyde and analyzed in a fluorescence-activated (FACS) cytofluorimeter (Becton Dickinson).

2.6 Statistical analysis

Data were expressed as means±SE. Multiple comparisons among all groups were performed by one-way factorial analysis of variance (ANOVA) followed by post hoc tests. A value of P<0.05 was considered statistically significant.

3 Results

3.1 Dose-dependent effects of AF-1 on LPS-induced cytokine release and expression in alveolar macrophages

To determine an appropriate concentration of AF-1 to be used in studies, AF-1 (0–10μg/ml) was added to purified AMs with or without LPS (0.5μg/ml). Cells stimulated with LPS alone served as positive controls, while PBS-stimulated AMs served as negative controls. As illustrated in Fig. 1, simultaneous incubation of AMs with LPS and various concentration of AF-1 for 20h resulted in a reduction in IL-1β and IL-6 release compared to cells stimulated with LPS alone. Inhibition by AF-1 was concentration dependent and was typically observed over a concentration range of 10ng/ml–10μg/ml. The inhibitory effects of AF-1 appeared to be maximal at 2μg/ml (up to 40%). In addition to inhibiting pro-inflammatory cytokine, AF-1 greatly enhanced the release of the anti-inflammatory cytokine IL-10.


Fig. 1

Dose–response inhibition of lipopolysaccharide stimulated by LPS (0.5μg/ml). IL-1β, IL-6 production and enhancement of IL-10 release (20h after stimulation) by AF-1 (0–10μg/ml) in alveolar macrophage from rats (representative experiment is shown). Effects of AF-1 are expressed as percentage of LPS-stimulated cytokine production in control cells.


The effects of AF-1 on cytokine mRNA expression in LPS-stimulated alveolar macrophages were also detected using quantitive real-time PCR. AF-1 inhibited mRNA expression of IL-1β and IL-6, but elevated IL-10 expression in AMs, in a dose-dependent manner (Fig. 2).


Fig. 2

Quantitive real-time PCR analysis of IL-1β, IL-6 and IL-10 mRNA expressed in AMs. The alveolar macrophages isolated from rats were treated with LPS (0.5μg/ml) in the presence of AF-1 (0–10μg/ml) for 6h. Total mRNA was isolated, and IL-1β, IL-6 and IL-10 mRNA expression was analyzed using quantitive real-time PCR. Bars represent relative copies of tested gene/GADPG of three independent repeats±SE.


In another experiment, cells were pre-incubated with LPS (0.5μg/ml) for 1h and washed extensively to remove the LPS. AF-1 (2μg/ml) was added to the cells; IL-1β and IL-6 release was determined 19h later. LPS triggered a significant release of IL-1β and IL-6 (P<0.01) by AMs. In the presence of AF-1, IL-1β and IL-6 release was dramatically inhibited (P<0.01; Fig. 3). It was also found that addition of AF-1 following LPS removal still inhibited IL-1β and IL-6 release (P<0.05). These data suggest that the inhibitory effects of AF-1 were not the result of direct interaction with LPS, but appeared to be a consequence that involved LPS signal transduction or that was mediated by another element.


Fig. 3

Production of cytokine IL-1β and IL-6 by alveolar macrophages in response to exposure for 1h to LPS (0.5μg/ml) followed by incubation for 19h in the presence or absence of AF-1 (2.0μg/ml). Each bar represents a mean of three independent experiments±SE. Compared with control *P<0.05; compared with LPS #P<0.05.


3.2 Effects of AF-1 on TLR-4 expression on LPS-stimulated alveolar macrophages

To further investigate whether the inhibitory effects of AF-1 on LPS-stimulated cytokine release were involved in impaired initiation of LPS signal transduction, LPS receptor toll-like receptor-4 on the cells surface was determined. Compared with the control, the mean fluorescence intensities of AMs were increased significantly in both the LPS-stimulated group and the LPS+AF-1 group (P<0.05; Fig. 4). A significant difference was also seen between those groups. This data indicate that LPS alone can upregulate TLR-4 expression on the cell surface of alveolar macrophages, but AF-1 has an inhibitory effect on the increase of LPS-induced TLR-4 expression in alveolar macrophages.


Fig. 4

TLR-4 expression on the cell surface of alveolar macrophages measured by flow cytometric analysis. Fluorescence intensity (x-axis) of the cells is plotted against cell counts (y-axis). Fluorescence signals from 5000 cells for each condition to determine mean fluorescence in density values for the fluorescence histogram. The mean fluorescence intensities for each profile were given in the up pane. AMs were treated with AF-1 (2μg/ml) with or without LPS stimulated for 6h. The shaded histogram A–C represents samples in which cells were incubated with AF-1 (2μg/ml), LPS (0.5μg/ml) or LPS+AF-1, respectively. The open histogram represents samples of control. This experiment is representative of six experiments performed. Compared with control *P<0.05; **P<0.01; compared with LPS+AF-1 #P<0.05.


3.3 Endogenous IL-10 involved in the inhibitory effects of AF-1 on pro-inflammatory cytokine release from LPS-stimulated alveolar macrophages

It is known that IL-10 produced by human monocytes following activation by LPS has strong downregulatory effects on the secretion of the pro-inflammatory cytokines IL-1β and IL-6. It is suggested that it is a powerful inhibitor of inflammation (Fiorentino et al., 1991; de Waal Malefyt et al., 1991). In order to investigate whether the inhibitory effects of AF-1 on cytokine release were the result of IL-10 induction, we neutralized the bioactivity of the IL-10 protein with neutralizing monoclonal antibodies. Blockade of IL-10 significantly affects the ability of AF-1 to inhibit pro-inflammatory cytokine IL-1β release (Fig. 5). This suggests that the inhibitory effect of AF-1 is partially dependent on the production of IL-10.


Fig. 5

Effect of AF-1 on LPS-induced release production of IL-1β and IL-6 after IL-10 was blocked. The alveolar macrophages isolated from rats were purified and cultured in fresh medium or fresh medium plus AF-1 (2.0μg/ml), in the presence or absence of anti-IL-10 antibody or isotype-matched control (anti-IgG1), and stimulated with 0.5μg/ml of LPS for 20h. Culture supernatants were analyzed for IL-1β and IL-6 by ELISA. The experiment was repeated six times and representative data are shown. AF-1: antiflammin-1; α-IL-10: anti-IL-10.


4 Discussion

Our study has demonstrated that AF-1 intervention results in changes to cytokine production in LPS-stimulated alveolar macrophages. These changes to cytokine expression and release in AMs suggest that AF-1 has the potential to impact the response of AMs to LPS. In addition, we observed that whereas AF-1 inhibited pro-inflammatory cytokine IL-1β and IL-6 expression in AMs, it promoted IL-10 expression, an endogenous anti-inflammatory cytokine. Our data also suggest that the inhibitory effects of AF-1 on pro-inflammatory cytokines expression, mainly of IL-1, are partly dependent on endogenous IL-10 production. Furthermore, the finding that AF-1 can downregulate toll-like receptor-4 expression on the surface of AMs suggests that AF-1 alters the sensitivity of AMs to LPS. As a consequence, AF-1 reduces the intensity of LPS-induced inflammation by modulating AM response to LPS via regulating TLR-4 expression and upregulating IL-10 secretion.

Bacterial endotoxin/LPS activate inflammatory cytokine release, thus causing tissue injury and acute inflammation. The early release of pro-inflammatory cytokines in response to LPS includes TNF-α, IL-1β and IL-6, which drives a cascade of inflammatory reactions, which in turn amplifies and extends the inflammatory reaction (Lomas-Neira et al., 2006). Monocytes/macrophages play a pivotal role in such processes by coordinating the immune and inflammatory response to infection and tissue injury. The findings that AF-1 inhibits IL-1β and IL-6 and promotes IL-10 production from alveolar macrophages suggest that AF-1, a synthetic peptide derived from CC10, may be a possible agent for treatment of inflammatory diseases.

IL-10 is a potent inhibitor of monocytes/macrophages function and its induction by LPS inhibits the production of pro-inflammatory cytokines (Hofstetter et al., 2005). In addition, IL-10 has been reported to repress the expression of a large fraction of LPS-induced pro-inflammatory genes, while its absence led to the overproduction of lethal cytokines after challenge with small amounts of LPS, or in some infections (Fierer, 2006). Our in vitro observation that AF-1 promoted IL-10 release from LPS-activated alveolar macrophages raised a question as to whether the release of IL-10 was responsible for the inhibitory effects of AF-1 on LPS-stimulated pro-inflammatory cytokine release.

To test this possibility, we blocked IL-10 activity with neutralizing antibodies. The results showed that the inhibitory effect of AF-1 on the release of IL-1β was diminished – but not IL-6 – by blocking the biological activity of IL-10 in LPS-activated AMs. Thus, the present study demonstrates that the inhibitory effect of AF-1 on pro-inflammatory cytokine release is at least partly dependent on it promoting endogenous production of IL-10 in LPS-stimulated alveolar macrophages.

TLRs are a family of proteins that recognize specific patterns of microbial components, especially those from pathogens, and regulate innate and adaptive immune responses (Takeda et al., 2003). The TLR family now consists of at least 13 members (TLR1–TLR13) in the mouse genome, whereas 11 TLRs have been found in humans (Takeda et al., 2003). The ligands for most TLRs have been identified. TLR-4 has been identified as a receptor for LPS, and TLR-4-deficient mice are hyporesponsive to LPS, demonstrating that TLR-4 is a critical receptor for LPS signaling (Hoshino et al., 1999). Studies have shown that many factors increase TLR-4 expression in lung tissue stimulated by LPS (Bozinovski et al., 2004). Our data demonstrate that LPS alone does alter the expression of TLR-4 on AMs surface, as showed by Fig. 4. This is supported by Zhang et al. (2003a), who reported that increased proteins of TLR-4 in alveolar macrophages stimulated with single-dose LPS (100ng/ml), but not by Maris et al. (2006), who reported that LPS did not alter the expression of TLR-4 in the LPS-stimulated macrophage cell line RAW264.7. Different cell types might account for the various results. In addition, our study showed that AF-1 repressed TLR-4 expression in LPS-stimulated AMs. This finding indicates that AF-1's inhibitory effect on LPS-activated macrophages is involved in both promoting anti-inflammatory cytokine IL-10 expression and inhibiting LPS receptor TLR-4 expression in macrophages.

The molecular function of AF-1 is not fully understood. Previous studies indicate that AF-1 possesses biological properties including inhibition of phospholipase A2, anti-inflammatory activities and regulation of the expression of adhesion molecules on human leukocytes. A contradictory effect of AF-1 on phospholipase A2 has also been reported (Rivers et al., 2002). Meanwhile, the relation of sPLA2 activation with cytokine release is still undetermined. Recent studies have proved that sPLA2 induced the production of cytokines and chemokines in human macrophages by a nonenzymatic mechanism (Moreno, 2006). Recently, researchers found that LPS-induced MAPK activation, the production of endogenous IL-10 and STAT-3 activation all play critical roles in SOCS-3 expression, which provides for feedback attenuation of cytokine-induced immune and inflammatory responses in macrophages (Qin et al., 2007). Ray et al. (2006) reported that UG (CC10) can downregulate SOCS-3 gene expression. These studies suggest that the inhibitory effects of AF-1 might be via SOCS-3 expression regulation. Our recent findings, that AF-1 can specifically bind to uteroglobin-binding protein and induce extracellular signal-regulated kinase 1 and 2 (Erk1/2) phosphorylation in NIH3T3 cells (Li et al., 2007), provide another possible signal transduction pathway to explain the mechanism of AF-1 inhibitory effects. Overall, the inhibitory effects of AF-1 on pro-inflammatory cytokines release are complicated and need to be further investigated.

In summary, this study provides new insights into the anti-inflammation mechanism of AF-1, by which AF-1 modulates AMs response to LPS and, as a consequence, inhibits inflammatory response in the lung after infection. It also suggests that AF-1 may be a potential candidate for the treatment of lung inflammation.

Acknowledgement

This work was supported by the National Natural Science Foundation of China (Proj. nos. 30440027 and 30400190).

References

Bozinovski S, Jones, JE, Vlahos, R, Hamilton, JA, Anderson, GP. Granulocyte/macrophage-colony-stimulating factor (GM-CSF) regulates lung innate immunity to lipopolysaccharide through Akt/Erk activation of NFkappa B and AP-1 in vivo. J Biol Chem 2002:277:45:42808-14
Crossref   Medline   1st Citation  

Bozinovski S, Jones, J, Beavitt, SJ, Cook, AD, Hamilton, JA, Anderson, GP. Innate immune responses to LPS in mouse lung are suppressed and reversed by neutralization of GM-CSF via repression of TLR-4. Am J Physiol Lung Cell Mol Physiol 2004:286:4:877-85
Crossref   1st Citation   2nd  

Carter AB, Knudtson, KL, Monick, MM, Hunninghake, GW. The p38 mitogen-activated protein kinase is required for NF-kappa B-dependent gene expression. The role of TATA-binding protein (TBP). J Biol Chem 1999:274:43:30858-63
Crossref   Medline   1st Citation  

Chowdhury B, Mantile-Selvaggi, G, Miele, L, Cordella-Miele, E, Zhang, Z, Mukherjee, AB. Lys 43 and Asp 46 in alpha-helix 3 of uteroglobin are essential for its phospholipase A2 inhibitory activity. Biochem Biophys Res Commun 2002:295:877-83
Crossref   Medline   1st Citation  

de Waal Malefyt R, Abrams, J, Bennett, B, Figdor, CG, deVries, JE. Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J Exp Med 1991:174:1209-20
Crossref   Medline   1st Citation  

Dierynck I, Bernard, A, Roels, H, De, LM. The human Clara cell protein: biochemical and biological characterisation of a natural immunosuppressor. Mult Scler 1996:1:6:385-7
Medline   1st Citation  

Fierer J. IL-10 and susceptibility to Coccidioides immitis infection. Trends Microbiol 2006:14:10:426-7
Crossref   Medline   1st Citation  

Fiorentino DF, Zlotnik, A, Mosmann, TR, Howard, M, O'Garra, A. IL-10 inhibits cytokine production by activated macrophages. J Immunol 1991:147:11:3815-22
Medline   1st Citation  

Fitzgerald KA, Palsson-McDermott, EM, Bowie, AG, Jefferies, CA, Mansell, AS, Brady, G. Mal (MyD88-adapter-like) is required for toll-like receptor-4 signal transduction. Nature 2001:413:6851:78-83
Crossref   Medline   1st Citation  

Girod CE, Shin, DH, Hershenson, MB, Solway, J, Dahl, R, Miller, YE. An alveolar type II and Clara cell specific protein with late developmental expression and upregulation by hyperoxic lung injury. Am J Respir Cell Mol Biol 1996:14:6:538-47
Medline   1st Citation  

Grattendick K, Stuart, R, Roberts, E, Lincoln, J, Lefkowitz, SS, Bollen, A. Alveolar macrophage activation by myeloperoxidase. A model for exacerbation of lung inflammation. Am J Respir Cell Mol Biol 2002:26:6:716-22
Medline   1st Citation  

Hofstetter C, Flondor, M, Hoegl, S, Muhl, H, Zwissler, B. Interleukin-10 aerosol reduces proinflammatory mediators in bronchoalveolar fluid of endotoxemic rat. Crit Care Med 2005:33:10:2317-22
Crossref   Medline   1st Citation  

Hoshino K, Takeuchi, O, Kawai, T, Sanjo, H, Ogawa, T, Takeda, Y. Cutting edge: toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol 1999:162:7:3749-52
Medline   1st Citation  

Ikegami M, Harrod, KS, Whitsett, JA, Jobe, AH. CCSP deficiency does not alter surfactant homeostasis during adenoviral infection. Am J Physiol 1999:277:5 Pt 1:983-7
1st Citation  

Janssens S, Burns, K, Tschopp, J, Beyaert, R. Regulation of interleukin-1- and lipopolysaccharide-induced NF-kappa B activation by alternative splicing of MyD88. Curr Biol 2002:12:6:467-71
Crossref   Medline   1st Citation  

Kradin RL, Sakamoto, H, Preffer, FI, Dombkowski, D, Springer, KM, Leary, CP. Accumulation of macrophages with dendritic cell characteristics in the pulmonary response to Listeria. Am J Respir Crit Care Med 2000:161:535-42
Medline   1st Citation  

Li C, Han, J, Li, L, Yue, S, Li, J, Feng, D. Interaction of antiflammin-1 with uteroglobin-binding protein induces phosphorylation of ERK1/2 in NIH 3T3 cells. Peptides 2007:28:11:2137-45
Crossref   Medline   1st Citation  

Lloret S, Moreno, JJ. In vitro and in vivo effects of the anti-inflammatory peptides, antiflammins. Biochem Pharmacol 1992:44:7:1437-41
Crossref   Medline   1st Citation  

Lomas-Neira J, Chung, CS, Perl, M, Gregory, S, Biffl, W, Ayala, A. Role of alveolar macrophage and migrating neutrophils in hemorrhage-induced priming for ALI subsequent to septic challenge. Am J Physiol Lung Cell Mol Physiol 2006:290:1:51-8
Crossref   1st Citation  

Losa GJ, Rodriguez, FM, Martin, CM, Garcia, SM, Losada, JP, Villaron, LG. Evaluation of inflammatory cytokine secretion by human alveolar macrophages. Mediat Inflamm 1999:8:1:43-51
Crossref   1st Citation  

Mantile G, Miele, L, Cordella-Miele, E, Singh, G, Katyal, SL, Mukherjee, AB. Human Clara cell 10-kDa protein is the counterpart of rabbit uteroglobin. J Biol Chem 1993:268:27:20343-51
Medline   1st Citation  

Maris NA, Dessing, MC, de, VA, Bresser, P, van, ZJ, Jansen, HM. Toll-like receptor mRNA levels in alveolar macrophages after inhalation of endotoxin. Eur Respir J 2006:28:3:622-6
Crossref   Medline   1st Citation  

Miele L. Antiflammins. Bioactive peptides derived from uteroglobin. Ann NY Acad Sci 2000:923:128-40
Medline   1st Citation  

Miele L, Cordella-Miele, E, Facchiano, A, Mukherjee, AB. Inhibition of phospholipase A2 by uteroglobin and antiflammin peptides. Adv Exp Med Biol 1990:279:137-60
Medline   1st Citation  

Moreno JJ. Effects of antiflammins on transglutaminase and phospholipase A2 activation by transglutaminase. Int Immunopharmacol 2006:6:2:300-3
Crossref   Medline   1st Citation  

Nakagawa R, Naka, T, Tsutsui, H, Fujimoto, M, Kimura, A, Abe, T. SOCS-1 participates in negative regulation of LPS responses. Immunity 2002:17:5:677-87
Crossref   Medline   1st Citation  

Peri A, Cordella-Miele, E, Miele, L, Mukherjee, AB. Tissue-specific expression of the gene coding for human Clara cell 10-kD protein, a phospholipase A2-inhibitory protein. J Clin Invest 1993:92:2099-109
Crossref   Medline   1st Citation  

Peri A, Dubin, NH, Dhanireddy, R, Mukherjee, AB. Uteroglobin gene expression in the rabbit uterus throughout gestation and in the fetal lung. Relationship between uteroglobin and eicosanoid levels in the developing fetal lung. J Clin Invest 1995:96:343-53
Crossref   Medline   1st Citation  

Plopper CG, Mango, GW, Hatch, GE, Wong, VJ, Toskala, E, Reynolds, SD. Elevation of susceptibility to ozone-induced acute tracheobronchial injury in transgenic mice deficient in Clara cell secretory protein. Toxicol Appl Pharmacol 2006:213:1:74-85
Crossref   Medline   1st Citation   2nd  

Poltorak A, He, X, Smirnova, I, Liu, MY, Van, HC, Du, X. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 1998:282:5396:2085-8
Crossref   Medline   1st Citation  

Qin H, Roberts, KL, Niyongere, SA, Cong, Y, Elson, CO, Benveniste, EN. Molecular mechanism of lipopolysaccharide-induced SOCS-3 gene expression in macrophages and microglial. J Immunol 2007:179:9:5966-76
Medline   1st Citation  

Ray R, Zhang, Z, Lee, YC, Gao, JL, Mukherjee, Anil B. Uteroglobin suppresses allergen-induced TH2 differentiation by down-regulating the expression of serum amyloid A and SOCS-3 genes. FEBS Lett 2006:580:6022-6
Crossref   Medline   1st Citation  

Rivers DB, Rocco, MM, Frayha, AR. Venom from the ectoparasitic wasp Nasonia vitripennis increases Na+ influx and activates phospholipase C and phospholipase A2 dependent signal transduction pathways in cultured insect cells. Toxicon 2002:40:1:9-21
Crossref   Medline   1st Citation  

Roger T, David, J, Glauser, MP, Calandra, T. MIF regulates innate immune responses through modulation of toll-like receptor 4. Nature 2001:414:6866:920-4
Crossref   Medline   1st Citation  

Singh G, Katyal, SL, Brown, WE, Kennedy, AL, Singh, U, Wong-Chong, ML. Clara cell 10-kDa protein (CC10): comparison of structure and function to uteroglobin. Biochim Biophys Acta 1990:1039:348-55
Medline   1st Citation  

Singh G, Katyal, SL. Clara cell proteins. Ann NY Acad Sci 2000:923:43-58
Medline   1st Citation  

Spiteri MA, Clarke, SW, Poulter, LW. Isolation of phenotypically and functionally distinct macrophage subpopulations from human bronchoalveolar lavage. Eur Respir J 1992:5:717-26
Medline   1st Citation  

Takeda K, Kaisho, T, Akira, S. Toll-like receptors. Ann Rev Immunol 2003:21:335-76
Crossref   1st Citation   2nd  

Ulevitch RJ, Tobias, PS. Recognition of gram-negative bacteria and endotoxin by the innate immune system. Curr Opin Immunol 1999:11:1:19-22
Crossref   Medline   1st Citation  

Wang SZ, Rosenberger, CL, Bao, YX, Stark, JM, Harrod, KS. Clara cell secretory protein modulates lung inflammatory and immune responses to respiratory syncytial virus infection. J Immunol 2003:171:2:1051-60
Medline   1st Citation  

Zhang DM, Li, YW, Mao, BL, Qian, GS. Down-regulation of Toll-like receptor 4 is related to the tolerance to lipopolysaccharide in rat alveolar macrophages. Zhonghua Jie He He Hu Xi Za Zhi 2003:26:7:411-4
Medline   1st Citation  

Zouki C, Ouellet, S, Filep, JG. The anti-inflammatory peptides, antiflammins, regulate the expression of adhesion molecules on human leukocytes and prevent neutrophil adhesion to endothelial cells. FASEB J 2000:14:3:572-80
Medline   1st Citation  


Received 13 December 2007/11 March 2008; accepted 25 April 2008

doi:10.1016/j.cellbi.2008.04.023


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)