Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2009) 33, 586–593 (Printed in Great Britain)
A GFP trap study uncovers the functions of Gilgamesh protein kinase in Drosophila melanogaster spermatogenesis
O.O. Nerusheva, N.V. Dorogova, N.V. Gubanova, O.S. Yudina and L.V. Omelyanchuk*
Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Lavrenteva 10, Novosibirsk 630090, Russia


Abstract

The function of the gene gilgamesh (89B9-12) encoding a casein kinase in Drosophila spermatogenesis was studied. The chimeric Gilgamesh–GFP protein in spermatocytes is cortically located. In the polar and apolar spermatocytes, it concentrates at the terminal ends of the fusome, the organelle that passes through the system of ring canals of the spermatocyte cyst. At the stage of spermatid elongation, the protein associates with the nucleus. A spot of the highest Gilgamesh–GFP concentration in the nucleus co-localizes with γ-tubulin in the basal body. At later stages, Gilgamesh is localized to the individualization complex (IC), leaving the nuclei somewhat before the IC investment cones, as detected by actin binding. The sterile mutation due to the gilgamesh gene leads to the phenotype of scattered nuclei and altered structure of actin cones in the individualizing spermatid cyst. Ultrastructural evidence confirmed defective spermatid individualization due to the mutation. The phylogenetic origin of the protein, and the connection between vesicular trafficking and spermatid individualization, are discussed.


Keywords: GFP-tag, Spermatogenesis, Ring canal, Basal body, Casein kinase, Phylogeny.

*Corresponding author. Tel.: +7 383 305 315.


1 Introduction

Green fluorescent protein (GFP) fusions make it possible to visualize the distribution of a studied protein in tissues and cells. The protein trap (GFP-tag transposon) contains the GFP exon flanked by donor and acceptor splicing sites. When inserted into a gene intron in an appropriate orientation and reading frame, this construction forms a new artificial exon containing the sequence encoding GFP. This makes it possible to form a fused full-sized protein–GFP product (Morin et al., 2001). A Drosophila protein–GFP tag library was obtained at Villefranche, France at the Laboratory of A Debec. Some GFP fusions from this collection have been characterized (Bobinnec et al., 2003; Franco et al., 2004; Karpova et al., 2006). Availability of insertions in such libraries gives the opportunity to commence genetic dissection of a function (in our case spermatogenesis) based on specific cellular localization of a protein in the tissue studied, rather than the analysis of mutant phenotype.

Spermatogenesis in Drosophila is an excellent system for analysis of the cellular and subcellular morphogenesis (Fuller, 1993). During spermatogenesis primordial germ cells undergo an oriented mitotic division to replace themselves and produce spermatogonia (reviewed in Lindsley and Tokuyasu, 1980; Fuller, 1993). Each spermatogonium undergoes 4 rounds of mitotic division, generating 16 spermatogonia that subsequently differentiate into spermatocytes within a cyst. Since the cytokinesis of mitotic divisions is incomplete, the spermatogonia are connected by ring channels. All 16 spermatocytes go through 2 rounds of meiotic divisions, resulting in a cyst of 64 haploid, round-shaped spermatids. The meiotic cytokinesis is also incomplete so the spermatids remain interconnected.

During the coalescence stage in early spermatids, mitochondria aggregate to the side of the nucleus where the centriole resides (Fuller, 1993). By the onion stage of spermatid differentiation, a dramatic transformation of the mitochondrial mass occurs. The individual mitochondria fuse into 2 giant mitochondria, which are arranged in a densely-packed sphere consisting of many layers of wrapped mitochondrial membranes (Lindsley and Tokuyasu, 1980). This onion-like structure is termed the Nebenkern. As the flagellar axoneme elongates, a dramatic change in the shape of the spermatid occurs (Lindsley and Tokuyasu, 1980). The 2 interlocked subunits of the Nebenkern unfold and extend along the growing axoneme. Despite the structural changes of the 2 mitochondrial derivatives, both mitochondrial subunits remain aligned and associated with axoneme. Following the flagellar elongation, the spermatid nucleus transforms its shape from a spherical structure to a long, thin needle. The process of individualization is initiated by the formation of the individualization complex (IC), containing the actin cones at the head region of the spermatid bundle (Fabricio et al., 1998). Individualization occurs in a cystic bulge, progressing along the entire length of the spermatid bundle. During individualization membrane remodeling takes place, the channels connecting spermatids are destroyed and syncytial organization of a cyst is lost (Fabricio et al., 1998). Following coiling of the sperm bundle, mature sperm are released into the testis lumen and then pass into the seminal vesicle.

As the differentiation of sperm from gonial cells is accompanied by extensive remodeling of every cellular organelle, this suggests sufficiently pronounced phenotypes of mutations in the genes controlling the corresponding processes.

We started by observing cellular protein localization; it was reasonable to expect that the range of the genes would also cover those whose functions were already known, but whose action in spermatogenesis had not been defined. We screened 30 GFP–tag insertions from the Villefranche Library for expression of GFP labeled proteins in spermatogenesis and found GFP fluorescence in the 20 cases. The GFP–tag insertion in the gene gilgamesh was chosen for further study due to its remarkable localization specific of each stage in germline cell development.

The protein kinase coded for by Drosophila melanogaster gene gilgamesh is a casein kinase gamma 1; it is involved in the control of glial cell migration and intercellular signaling (Hummel et al., 2002). Screening of the genes involved in drosophila spermatogenesis was performed earlier (Schulz et al., 2004). The authors conducted ectopic induction of a set of EP-element insertions in a germ line and the somatic component of gonad tissue and demonstrated that the misexpression caused by EP element inserted in the gish locus led to apoptosis of 16-cell cysts before they differentiated into spermatocytes. This effect was caused by the driver ptc-Gal4, which induced an ectopic expression in the gonad somatic tissue and was absent in the presence of the driver nanos-Gal4, specific of early spermatogenesis stages (Schulz et al., 2004). The goal was to study the localization of the fused protein at various spermatogenesis stages and the sterile phenotypes caused by different alleles of this gene, as well as to describe the origin and function of this protein using bioinformatics methods.

2 Materials and methods

The strain w1118; P{w+mC=PTT-un1}gish95-1 from the Villefranche Collection of GFP tags was used in this study. The sterile gish allele was obtained from Bloomington Stock Center (ry506 P{ry+t7.2=PZ}gish04895/MKRS; no. 11790).

For fluorescence microscopy, the testes isolated in Hank's solution from adult males were dissected with a needle, spread over a glass slide covered with polylysine, fixed at a room temperature with 7% formaldehyde in phosphate buffer (PBS) pH 7.2 for 20min, and washed with PBS for 10min. The fixed tissue was permeabilized with 1% Triton X-100 in PBS for 30min and treated for 1h with blocking solution (1% defatted dry milk and 1% Triton X-100 in PBS) to incubate the slides with primary antibodies at 4°C overnight, washed twice for 10min, and incubated with the secondary antibodies at 37°C for 1h. The nuclei were visualized with DAPI (2μg/ml). After staining the preparations were washed with PBS and mounted into Mowiol with 10% DABCO (Sigma) to prevent fading. The slides were examined using Carl Zeiss fluorescent microscopes (Service Center with the Institute of Cytology and Genetics). The stage of spermatid development was assessed according to the degree of nucleus remodeling during elongation.

The antibodies to mouse γ-tubulin (Sigma) were diluted to 1:1000 with blocking solution; the secondary goat antimouse Cy-3-labeled antibodies (AbCam), to 1:400. F-Actin was visualized with phalloidin-TRITC (Molecular Probe) at a dilution of 1:2000.

For electron microscopy, the testes were isolated in Hank's solution, fixed for 2h with 2% glutaraldehyde solution in 0.1M PBS pH 7.4, and postfixed for 1h with 1% OsO4 solution in the same buffer. Then the samples were incubated in aqueous 1% uranyl acetate solution overnight at 4°C. After dehydration in a series of alcohol with increasing concentrations, the tissue was saturated with the resin Agar-100, mounted in standard blocks, and polymerized for 2–3 days at 60°C. Ultrathin sections were obtained using a Riechert Jung microtome, contrasted with 1% uranyl acetate and lead citrate according to Reynolds (1963), and examined with a JEOL 1000SX (Japan) electron microscope.

3 Results

The GFP-tag strain was obtained earlier by Debec's team as P{w+mC=PTT-un1}-element insertion. Sequencing of the DNA region adjacent to the insertion localized the insertion site between nucleotides 8434 and 8435 in the genome contig (3R:12098176, 12128095). The P element was inserted into the intron between coding exon 1 (2692–2717) and exon 2 (9029–9243) of gish gene. We sequenced the 5′-region of genomic DNA adjacent to the P element using the primer pair CACCCAAGGCTCTGCTCCCACAAT and CAATCATATCGCTGTCTCACTCA and the 3′-region with the primer pair GGATCCCTTACCGGCTTGGTTC and CCAAAGCAGCAAAAGAAACAGC. The localization of insertion coincided with that determined by Debec's team; in addition, we found that the P-element insertion brought forth the direct repeat TGCGCCGGA with a length of 9bp, which coincides with the earlier detected longest repeat caused by P-element insertion (Ashburner, 1989). Three reading frames in gish gene are known, starting at 2692, 8456, and 16 842 nt. The insertion in question is localized in such a way that the Gish–GFP fusion can appear only when the translation starts from exon 1. The 3 forms of P{w+mC=PTT-un1} element used as a GFP trap differ in the GFP reading frames. For exon 1 and GFP reading frames to coincide, it is necessary to use the pPGB variant for producing the insertion in question.

The Gish fused protein has a cortical localization at the stages of spermatogonia and spermatocytes (Fig. 1a and b). In young spermatocytes, the protein is located not only on the plasma membrane, but also in the cytoplasm as small granules (Fig. 1a), which accumulate with time to form a single round-shaped structure in the polar spermatocytes (Fig. 1b). This structure disappears in meiosis, and the GFP fluorescence in the cell cortical region fades (Fig. 1c), remaining at the same level at the onion stage. By the beginning of elongation, the protein loses its cortical localization to reappear soon as a small granule near the nucleus base (Fig. 1d) in the region of spermatid basal body, which is known to be a centrosome derivative (Fuller, 1993). However, the protein becomes detectable not only in the basal body, but also in the nucleus (Fig. 1e) with the nucleus elongation and compaction. At later elongation stages Gish binding in the basal body ceases, yet a nuclear localization of Gish is retained (Fig. 1f). The nuclear location of this protein is also transient as Gish–GFP leaves the nucleus at a later stage, when the nucleus reaches its final length and compaction. Individualization commences at about the same time; this is a wave of cell membrane remodeling directed from the basal cyst end (where the nuclei are located) to its apical end.


Fig. 1

Localization of the Gish–GFP fusion during spermatogenesis. At the spermatogenesis stages before spermatid elongation, Gish localizes to the plasma membrane of germline cells (a–c). Young spermatocytes display individual Gish-containing granules (a and b, arrow), gradually aggregating to form a single structure (b), which is absent in meiosis and at the onion stage (c). By the end of spermatid elongation, Gish protein disappears from the cell membrane and soon commences accumulating at the nuclear base, forming a separate granule (arrow at (d)). At the moment the nucleus elongation (but not compaction) is almost completed, Gish is detectable not only within the granules (e, arrow), but also in the spermatid nuclei (e, arrowhead) and soon remains only in these nuclei (f). By the beginning of spermatid individualization, when the nuclei have already acquired a needle-shaped structure, Gish leaves the nuclei within granular–tubular structures (g). These structures move along the cyst within the individualization complex; however, Gish is concurrently detectable as cones of the individualization complex (h). On completion of individualization, almost all Gish-containing structures are cleaved from the cyst within the waste bag (i). Bar – 10μm.


The cyst at the spermatocyte stage contains a well-developed fusome, the organelle passing through the system of ring canals connecting the cells of one cyst into syncytium. It is visualizable with the help of TRITC-conjugated phalloidin (Hime et al., 1996). The round-shaped structure containing Gish–GFP neighbors the terminal region of a fusome branch (Fig. 2a). The immunocytochemical staining of the testes with the antibodies to γ-tubulin, present in the centrosome, demonstrates that the regions of Gish and γ-tubulin binding overlap (Fig. 2b), i.e. the protein in question at this stage is localized in the basal body.


Fig. 2

Colocalization of Gish–GFP fusion with various cellular structures in male germline cells. Cells are stained with TRITC-conjugated phalloidin for visualizing F-actin (a, c, and d) and antibodies to γ-tubulin and DAPI (b) for visualizing DNA. In spermatocytes, Gish is detectable in the region of plasma membrane, which is confirmed by its colocalization with F-actin in this cell compartment (a). At the spermatogenesis stage, a round-shaped Gish-containing intracellular structure is present (a, arrow), with a characteristic location near the terminal parts of fusome branches (a, arrowhead). During the elongation, Gish–GFP co-localizes with the basal body. During the initiation of individualization, the Gish-containing structures leave the nuclei before the actin cones of individualization complex (c). Later, the bundle of actin cones moves together with Gish granules, and a certain amount of this protein is also detectable in the cones (d). Bar – 10μm.


Cyst remodeling involves the individualization complex, which contains F-actin-rich investment cones (Figs. 2c, d and 3c), physiological with fluorescently labeled phalloidin (Fabricio et al., 1998). The TRITC-labeled phalloidin staining also showed that Gilgamesh granules leave the nucleus before the F-actin-rich investment cones of individualization complex (Fig. 2c). During further individualization the protein is detectable both in the actin cones and as granules scattered over the cyst (Figs. 1h and 2d). At the end of individualization stage all the structures containing the protein are discharged from the cyst to the waste bag. Note that the morphology of the cones in the waste bag differs from that during individualization (Fig. 1i).

The sterile males homozygous at gish04895 are detectable in the strain ry506 P{ry+t7.2=PZ}gish04895/MKRS and can be identified according to the absence of the marker Sb, linked to the balancer MKRS. Study of the spermatogenesis in such males has demonstrated that any abnormalities are absent until the onion stage spermatids. At the stage of spermatid elongation we observed that the abnormalities in the nuclei forming a dense bundle in the wild type (Fig. 3a) were scattered over the cyst in its basal third (Fig. 3b), which is characteristic of many mutations interfering with the individualization process (Fabricio et al., 1998).


Fig. 3

Abnormalities of spermatogenesis in gish04895 mutants. (a) In wild type, the spermatid nuclei form a bundle; (b) in gish0489 mutants, the spermatid nuclei are scattered over the cyst in its basal third; (c) in wild type, the actin cones are consolidated in a bundle; and (d) in gish04895 mutants, the actin cones lose their consolidation. DAPI-blue, Actin-red. Bar – 10μm.


In the wild type, the individualization results in the spermatids that initially forming a syncytium acquiring individual plasma membranes, while the material that becomes unnecessary is discharged from the cyst within the waste bag (Fuller, 1993). Fig. 3c and d shows the wild type and mutant individualization complexes. It is evident that the actin cones in mutants fail to form a bundle, which is characteristic of many mutations impairing the individualization process (Fabricio et al., 1998).

With ultrastructural examination of the individualization process, Fig. 4a shows a cross-section of a wild-type cyst with the axonemes (arrow head) and the associated mitochondrial derivatives (arrow). Fig. 4b is a cross-section of a gish mutant, similar to the section shown in Fig. 4a in a horseshoe-shaped morphology of the major mitochondrial derivative, which is characteristic of late individualization stages (Lindsley and Tokuyasu, 1980). It is evident that the association between the axoneme and mitochondrial derivative (arrow heads) is lost in many cases. As the association between mitochondrial derivative and the axoneme appears at the comet stage, the abnormality in question must develop later—at the late elongation stage or individualization stage. In addition to the major horseshoe-shaped mitochondrial derivative, the mutant spermatids also contain the minor mitochondrial derivative displaying the morphology characteristic of the early individualization stage (Fig. 4b, insert). These data comply well from the standpoint that mutant gish leads to abnormalities in the spermatid morphology at the individualization stage.


Fig. 4

Electron microscopy of individualization abnormalities in gish0489 mutants. (a) Cross-section of a wild-type cyst after passing of the individualization complex; the axoneme (black arrow head) is tightly associated with the mitochondrial derivative (black arrow). (b) Cross-section of a mutant cyst; many mitochondrial derivatives are unassociated with the axoneme (white arrow heads); the major mitochondrial derivative (black arrow) has a horseshoe shape (characteristic of the final individualization stage), whereas the morphology of the minor mitochondrial derivative (white arrow) corresponds to the early individualization.


Completed and on-going genomic projects permit the identification of the representative set of protein family members from the different eukaryotic species. For many eukaryotic genes, their molecular function has already been assigned by advanced yeast genetics. This information can also be used for the other model objects. To transfer the functional assignments from one object to another it is necessary to ensure that the considered proteins are orthologous. Thus we carried out bioinformatic and evolutionary analysis of Gish protein-kinase homologs from different organisms, including yeast.

Our first step was to find the yeast proteins similar in their sequences to the drosophila Gish protein because the protein kinase family is well-represented for yeasts. We searched the Saccharomyces Genome Database (http://www.yeastgenome.org/) and found certain Saccharomyces cerevisiae proteins displaying the greatest similarity to the drosophila protein: YCK2/YNL154C, YCK1/YHR135C, YCK3/YER123W, and HRR25/YPL204W. The first 2 proteins are casein kinases associated with the plasma membrane and involved in the septin assembly and endocytosis. The third protein is a casein kinase localized to the vacuole membrane and regulating the vacuole fusion in a negative fashion. The function of this protein overlaps with that of HRR25 protein. The function of the fourth protein, a homolog of casein kinase delta 1, differs considerably—this is a protein kinase involved, on the one hand, in the vesicular trafficking and, on the other, in DNA repair, chromosome segregation and gene expression (the last function is realized via protein binding to the CTD repeat of RNA polymerase II (Phatnani et al., 2004)).

To ascribe the Drosophila Gilgamesh casein kinase to one of these 4 classes, we extracted the following human casein kinase sequences from the Expasy database (http://cn.expasy.org): P48730, delta isoform; Q9HCP0, gamma 1 isoform; P78368, gamma 2 isoform, Q9Y6M4, gamma 3 isoform, and Q4JJA0, alpha 1 isoform. To distinguish between the divergence of isoforms and the species divergence in the phylogenetic tree, we found the following Xenopus protein sequences in Expasy: Q5EAV0 (Xenopus laevis), a casein kinase 1 gamma isoform not ascribed to 1, 2, or 3 form; Q3LS18 (Xenopus tropicalis), gamma 2 isoform; Q6GL54 (X. tropicalis), another gamma 2 isoform; and Q6GN14 (X. laevis), unclassified protein. The product corresponding to the longest transcript of gish CG6963-PB gene was selected as the protein representing Drosophila. The sequence of unannotated Caenorhabditis elegans protein Q8WQ99 and the sequence of human protein kinase 2 A2A2H9 as the sequence of external ancestor were additionally included in the analysis. ClustalX was used to homologously align the above listed protein sequences and construct the phylogenetic tree (Fig. 5). From the topology of this tree, the most ancient dichotomy is seen by the separation of HRR25 nuclear cytoplasmic kinase (and, as appeared, alpha and delta casein kinases cognate to this isoform) and the ancestral forms of cytoplasmic S. cerevisiae YCK3, YCK2, and YCK1 (and animal casein kinases gamma, cognate to these forms). The tree branches corresponding to this dichotomy display large bootstrap values (exceeding 900), indicating a high significance of the dichotomy in question. The tree topology demonstrates that the frog protein Q5EAV0 is a gamma 3 isoform, while the X. tropicalis Q6GL54 and Q3LS18 must be ascribed to gamma 1 rather than gamma 2 isoform. In contrast, the unclassified X. laevis protein Q6GN14 belongs rather to gamma 2 isoform.


Fig. 5

Phylogenetic tree reflecting the divergence of casein kinases 1. Branch lengths show below each of the branch and bootstrap values.


4 Discussion

The intracellular distribution of the chimeric Gish–GFP protein suggests the cellular structures that can be targets for the Gilgamesh protein, namely the cortical membrane, fusome, basal body, spermatid nucleus and individualization complex. The sterile gish allele shows an abnormality in spermatid individualization appearing as a phenotype of scattered nuclei and altered morphology of the bundle of actin cones. It fits well with the localization of the fused protein within the individualization complex. This result increases our knowledge of the function of this protein kinase in the male gonads (Schulz et al., 2004). Our phylogenetic analysis has demonstrated that the earliest event in the evolution of casein kinases 1 was the divergence between the YCK1, YCK2 and YCK3 ancestral isoform and the HRR25 ancestral isoform. Presumably this divergence occurred in unicellular organisms. The structure of the subtree corresponding to the divergence of animal gamma isoforms fits well with the divergence of animal species. The unexpected result of the second earliest event in the evolution of casein kinases 1 was the divergence between the yeast HRR25 ancestral form (and the cognate animal alpha and delta isoforms) and the ancestral animal gamma isoform. From the formal standpoint, this suggests that the animal gamma isoform can share the function with the nuclear-cytoplasmic kinase HRR25, but this interpretation is incorrect. Mammalian gamma casein kinase 1 can substitute the function of YCK1 and YCK3 proteins, restoring the colony growth and morphology in the double mutants yck1 yck2 (Zhai et al., 1995), proving that these proteins have a common function. The mammalian casein kinase delta can restore the growth abnormality of the cells mutant at HRR25, thereby also showing a common function in this case (Fish et al., 1995). Thus the nuclear-cytoplasmic protein kinase appeared in the phylogenetic branch leading to the yeast HRR25 and the animal alpha and delta protein kinases. However, the animal gamma isoform retained the cytoplasmic function of its ancestor.

Vesicular trafficking and spermatid individualization are processes of membrane remodeling. They are also similar from the standpoint of genetic control. The molecular function is known for 4 mutations affecting individualization of the 9 studied (Fabricio et al., 1998). In 2 cases (dud and cbx), the products are involved in protein ubiquitination, whereas in the other cases (Chc4 and scat), the products are the proteins directly involved in the vesicular trafficking. Monoubiquitination is a marker of internalization of yeast cell receptors (Seto et al., 2002); therefore, it is probable that the first 2 genes are also involved in the vesicular trafficking. Our data on Gish protein confirm that we have the protein involved in spermatid internalization and that displays a very close relation to the genes of yeast vesicular trafficking.

Acknowledgements

The work was supported by the Russian Foundation for Basic Research (project no. 05-04-48316).

References

Ashburner M. Drosophila: a laboratory manual. 1989:
1st Citation  

Bobinnec Y, Marcaillou, C, Morin, X, Debec, A. Dynamics of the endoplasmic reticulum during early development of Drosophila melanogaster. Cell Motil Cytoskel 2003:54:3:217-25
Crossref   1st Citation  

Fabricio J, Hime, G, Lemmon, S, Bazinet, C. Genetic dissection of sperm individualization in Drosophila melanogaster. Development 1998:125:1833-43
Medline   1st Citation   2nd   3rd   4th   5th   6th  

Fish KJ, Ceqielska, A, Getman, ME, Landes, GM, Virshup, DM. Isolation and characterization of human casein kinase I epsilon (CKI), a novel member of the CKI gene family. J Biol Chem 1995:270:25:14875-83
Crossref   Medline   1st Citation  

Franco B, Bogdanik, L, Bobinnec, Y, Debec, A, Bockaert, J, Parmentier, M-L. Shaggy, the homolog of glycogen synthase kinase 3, controls neuromuscular junction growth in Drosophila. J Neurosci 2004:24:29:6573-7
Crossref   Medline   1st Citation  

Fuller M. Spermatogenesis. The development of Drosophila melanogaster 1993:71-147
1st Citation   2nd   3rd   4th   5th  

Hime GR, Brill, JA, Fuller, MT. Assembly of ring canals in the male germ line structural components of the contractile ring. J Cell Sci 1996:109:2779-88
Medline   1st Citation  

Hummel T, Attix, S, Gunning, D, Zipursky, SL. Temporal control of glial cell migration in the Drosophila eye requires gilgamesh, hedgehog, and eye specification genes. Neuron 2002:33:2:193-203
Crossref   Medline   1st Citation  

Karpova N, Bobinnec, Y, Fouix, S, Huitorel, P, Debec, A. Jupiter, a new Drosophila protein associated with microtubules. Cell Motil Cytoskel 2006:63:301-12
Crossref   1st Citation  

Lindsley DL, Tokuyasu, KT. Spermatogenesis. Genetics and biology of Drosophila 1980:225-94
1st Citation   2nd   3rd   4th  

Morin X, Daneman, R, Zavortink, M, Chia, W. A protein trap strategy to detect GFP-tagged proteins expressed from their endogenous loci in Drosophila. Proc Natl Acad Sci USA 2001:98:26:15050-5
Crossref   Medline   1st Citation  

Phatnani HP, Jones, JC, Greenleaf, AL. Expanding the functional repertoire of CTD kinase I and RNA polymerase II: novel phosphoCTD-associating proteins in the yeast proteome. Biochemistry 2004:43:50:15702-19
Crossref   Medline   1st Citation  

Reynolds ES. The use of lead citrate at high pH as an electron-opaque stain in electron microscopy. J Cell Biol 1963:17:208-12
Crossref   Medline   1st Citation  

Schulz C, Kiger, AA, Tazuke, SI, Yamashita, YM, Pantalena-Filho, LC, Jones, DL. A misexpression screen reveals effects of bag-of-marbles and TGF beta class signaling on the Drosophila male germ-line stem cell lineage. Genetics 2004:67:2:707-23
1st Citation   2nd   3rd  

Seto ES, Bellen, HJ, Lloyd, TE. When cell biology meets development: endocytic regulation of signaling pathways//. Genes Dev 2002:16:11:1314-36
Crossref   Medline   1st Citation  

Zhai L, Graves, PR, Robinson, LC, Italiano, M, Culbertson, MR, Rowles, J. Casein kinase I gamma subfamily. Molecular cloning, expression, and characterization of three mammalian isoforms and complementation of defects in the Saccharomyces cerevisiae YCK genes. J Biol Chem 1995:270:12717-24
Crossref   Medline   1st Citation  


Received 15 May 2008/2 October 2008; accepted 25 February 2009

doi:10.1016/j.cellbi.2009.02.009


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)