Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2009) 33, 758–764 (Printed in Great Britain)
Comparison of murine dental follicle precursor and retinal progenitor cells after neural differentiation in vitro
Wolfgang Ernsta, Michael Saugspiera, Oliver Felthausbc, Oliver Driemelc and Christian Morsczeckb*
aInstitute of Human Genetics, University of Regensburg, Franz-Josef-Strauß-Allee 11, 93053 Regensburg, Germany
bDepartment of Operative Dentistry and Periodontology, University of Regensburg, Franz-Josef-Strauß-Allee 11, 93053 Regensburg, Germany
cDepartment of Oral and Maxillofacial Surgery, University of Regensburg, Franz-Josef-Strauß-Allee 11, 93053 Regensburg, Germany


Abstract

Human dental stem or precursor cells can differentiate into multiple cell types like adipocytes, osteoblasts or chondrocytes. Recently, a number of different human dental stem cell lines were differentiated into neurons. This makes dental stem cells interesting as possible cell-based therapeutics for neural degenerative diseases. To test this hypothesis, we have investigated the neural differentiation potential of murine dental follicle precursor cells (mDFPCs). The mDFPC cell line was newly established without cell immortalization. After differentiation, neural cell marker expression in mDFPCs was checked and compared with that of murine retinal progenitor cells (mRPCs). Differentiated mDFPCs became neuron-like cells with small cell bodies and long/branching neurites, similar to differentiated mRPCs. However, mRPCs showed more complete neural differentiation. Furthermore, 5% of the differentiated mDFPCs and 37% of the differentiated mRPCs were positive for the glia cell marker GFAP (glial fibrillary acidic protein). The data presents new evidence of neural differentiation of mDFPCs, but only a small percentage of mDFPCs differentiated into glia cells, unlike mRPCs.


Keywords: Dental follicle cells, Neural differentiation, Neural degeneration, Retinal progenitor cells.

*Corresponding author. Tel.: +49 (0) 941 9446161; fax: +49 (0) 941 9446025.


1 Introduction

Although medical progress has increased our expectancy of life, neural degeneration has not been adequately addressed. Different neural tissues have been considered in stem cell-based therapy. The retina is one important target for therapy in the near future because it is easily accessible than other neural tissues, and the chamber of the eye is not heavily infiltrated by immune cells, making rejection less likely than for other tissues. Retinal progenitor cells (RPCs) have recently been found in mammals and represent promising candidates for cell-based retinal therapy (Canola et al., 2007; MaClaren et al., 2006). RPCs can differentiate into neural and retinal specific cell types (Klassen et al., 2007; Tropepe et al., 2000). However, retinal progenitor cells are rare in adult retinas, and RPCs do not proliferate well under in vitro conditions, unlike neural stem cells (Engelhardt et al., 2004). Non-retinal precursor cells are therefore an alternative source for a cell-based therapy of the retina. Tomita et al. (2006) demonstrated that bone marrow stromal cells (BMSCs) differentiate into cells expressing neural and glial cell markers, but RPCs showed more complete neural differentiation under in vitro conditions.

Another source for easily accessible stem cells are dental stem/precursor cells (Modino and Sharpe, 2005; Morsczeck et al., 2005). Dental cells, like dental follicle precursor cells and dental pulp cells, are neural crest derived (Lumsden, 1988). Because neural crest stem cells can differentiate into neural cells in vivo (Lasky and Wu, 2005; Pardal et al., 2007), dental stem cells should possess a greater potential for neural differentiation than BMSCs that are of mesenchymal origin. Importantly, stem cells from human exfoliated deciduous teeth (SHED) differentiated into a variety of cell types, including neural cells (Miura et al., 2003). After in vivo transplantation into the dentate gyrus of immunocompromised mice, SHED survived inside the mouse brain microenvironment and continued to express neural markers (Miura et al., 2003). Widera et al. (2007) have successfully isolated and cultivated human dental neural precursor cells by minimally invasive periodontal surgery. Moreover, Arthur et al. (2008) found that human dental pulp stem cells differentiated into neurons. Recently, Yao et al. (2008) have demonstrated neural differentiation of rat dental follicle cells. In summary, dental stem cells are putative therapeutics for neural degenerative diseases. Murine dental cells as neural progenitors would be an excellent tool for the evaluation of tissue regeneration in mouse models. However, neural differentiation has not been seen in murine dental stem cells until today. In contrast to human dental follicle cells, murine dental follicle cells have to be immortalized for proliferation in vitro (Luan et al., 2006). These authors found that each of cloned immortalized dental follicle cell lines had remarkably unique characteristics, indicative of a separate and distinct lineage. These immortalized cell lines displayed different and restricted differentiation potentials. However, immortalized cells may have altered differentiation potentials and are consequently not useful for the evaluation of neural differentiation.

One of our goals, therefore, was to isolate and culture murine dental follicle precursor cells (mDFPCs) from mouse tooth germs similar to human dental follicle cells with and without immortalization (Morsczeck et al., 2005). This was followed by investigation of the neural differentiation potential of mDFPCs under in vitro conditions, which was compared with murine RPCs (mRPCs) after neural differentiation. Cell morphologies were analysed, and gene expression levels of neural cell markers by immunocytochemistry and real-time RT-PCR compared.

2 Materials and methods

2.1 Isolation of murine dental follicle precursor cells (mDFPCs)

mDFPCs were isolated by a modified protocol (Morsczeck et al., 2005). Briefly, C57BL/6 mice (postnatal day 9 and younger) were anesthetized and killed by cervical dislocation. Mandibles were dissected and the dental follicles from developing molar teeth were pooled in PBS. Two mDFPC cell lines were established: mDFPCs1 (postnatal day 5) and mDFPCs2 (postnatal day 9). [In Figs. 1–3 mDFPCs2 are shown representatively. The dental follicles were digested in a solution consisting of 1mg/ml collagenase, 2mg/ml hyaluronidase, 0.3mg/ml DNAse I (Sigma–Aldrich, Taufkirchen, Germany), and PBS (PAA, Pasching, Austria) for 40min at 37°. Enzymatic digestion was stopped by adding cultivation medium. The solution was forced through a cell strainer (70μm) to prepare a single cell suspension. Cultures were established by seeding the suspension into 25cm2 (T25) cell culture flasks (Nunc, Wiesbaden, Germany) in cultivation medium, Mesenchym Stem Medium supplemented with 100μg/ml penicillin/streptomycin (PAA).


Fig. 1

Characterization of isolated mDFPCs and mRPCs. (A) mDFPCs cultivated in standard medium formed self-adherent monolayers and could be propagated for >15 passages (Scale bar=50μm). (B) Calcium accumulation was observed by alizarin staining in long-term cultures of mDFPCs after 4 weeks of induction with dexamethasone. No calcium accumulation was observed in long-term control cultures after 4 weeks (data not shown). (C) RT-PCR analysis of cultured mDFPCs: Two representative cell lines were positive for the neural crest markers Sox9 and Snail, the osteoblast marker Osteocalcin, the mesenchymal marker Vimentin, and the dental follicle cell associated cell markers collagen type I, Notch1 and Nestin. To exclude genomic DNA contaminations, a –RT was conducted for the housekeeper GAPDH. (D) mRPCs cultivated in serum-replacement medium formed self-adherent monolayers (Scale bar=50μm). Cells were extracted at postnatal day 0 and could proliferate beyond passage 18. (E) Immunofluorescence of mRPCs for the neural progenitor cell marker Nestin (DAPI for nuclear staining). (F) RT-PCR: 4 representative mRPCs cell lines expressed the progenitor marker, nestin, the neuroepithelial marker, Pax6, the neural stem cell marker, Sox2, and the proliferation marker, Ki67. To rule out contaminations of genomic DNA, a –RT was conducted for the housekeeper GAPDH.


Fig. 2

Neural differentiation of mDFPCs (A, C, E, G, I) and mRPCs (B, D, F, H, J). (A) Differentiated mDFPCs showed a neuron-like cell morphology in comparison to undifferentiated cells (Fig. 1). (B) mRPCs differentiated into cells with neuron-like morphologies or into flattened shaped cells similar to isolated glial cells. Representative images of mDFPC and mRPCs stained with neural cell markers β-III tubulin (C, D), neurofilament (E, F), MAP2ab (G, H) and GFAP (I, J). Abbreviation: Tubb3: β-III tubulin; NF: neurofilament.


Fig. 3

(A) Quantification of positively stained mDFPCs and mRPCs for specific antibodies for tubb3, Map2ab, GFAP and NF represented as the percentage of the field of view. GFAP was expressed in >35% of mRPCs, but only in 5% of mDFPC. (B) A real-time RT-PCR analysis was done after differentiation of mDFPCs and mRPCs. In contrast to immunocytochemical analyses, gene expression levels were higher in differentiated mRPCs than in differentiated mDFPCs. For relative gene expression, samples were calibrated to undifferentiated mRPCs (relative gene expression=1). Each bar represents the average of two experiments. Error bars denote the range between experiments. Abbreviation: Rho: rhodopsin; Tubb3: β-III tubulin; NF: neurofilament.




2.2 Osteogenic differentiation

For osteogenic differentiation, mDFPCs were cultivated in alpha-MEM (PAA) supplemented with 10% fetal bovine serum (PAA), 100μmol/l-ascorbic acid 2-phosphate, 2.8mmol/l KH2PO4, 1×10−7mol/l dexamethasone sodium phosphate, HEPES (20mmol/l) (Sigma–Aldrich) and 100μg/ml penicillin/streptomycin (PAA) for 4 weeks. Alizarin red staining was done as previously described (Morsczeck et al., 2005). mDFPCs were cultivated in Mesenchym Stem Medium supplemented with 100μg/ml penicillin/streptomycin (PAA) for control (data not shown).

2.3 Isolation of murine retinal progenitor cells (mRPCs)

A modified protocol of Angenieux et al. (2006) was used to isolate murine retinal progenitor cells (mRPCs). Briefly, 7–10 C57BL/6 mice (postnatal day 0) were anesthetized and killed by cervical dislocation. The ciliary marginal zone and the optic nerve head were surgically removed from the eyes. Retinal tissues were digested in a solution of 1mg/ml collagenase, 2mg/ml hyaluronidase and 0.3mg/ml DNAse I and PBS at 37°C for 40min. Enzymatic activity was stopped by adding cultivation medium. Supernatant containing liberated cells was forced through a 70μm mesh strainer and washed 3 times in cultivation medium. Cells were resuspended in cultivation medium (D-MEM F12 Glutamax, N2 supplement (Invitrogen, Karlsruhe, Germany), 20ng/ml FGF-2, 20ng/ml EGF (Biomol, Hamburg, Germany), 100μg/ml Penicillin/Streptomycin) and plated in T25 cell culture flasks.

2.4 Neural differentiation

For neural differentiation of mDFPCs, cells were plated at 15×104 cells/cm2 and cultivated under differentiation conditions for 5 days (D-MEM F12 Glutamax, N2 supplement, 20ng/ml FGF-2, 20ng/ml EGF, 5μM retinoic acid, 100μg/ml penicillin/streptomycin). For neural differentiation of mRPCs, cells were plated at 510×104 cells/cm2 and cultivated for one day in medium with 0.5μM retinoic acid followed by 4 days in D-MEM F12 Glutamax, N2 supplement, and 0.5μM retinoic acid.

2.5 Immunocytochemistry

Cells were seeded in 4-well chamber slides (Nunc, Wiesbaden, Germany) and cultivated as above before being fixed with 4% paraformaldehyde (Roth, Karlsruhe, Germany) for 30min at room temperature. After fixation, paraformaldehyde was removed and the cells washed with TBS (Tris-buffered saline). The cells were blocked with fish skin gelatin buffer (FSGB) solution (0.1M Tris–HCl (pH 7.5), 0.15M NaCl, 1% w/v BSA, 0.2% v/v fish skin gelatin) containing 0.1% Triton X-100 for 2h. Primary antibody mouse anti Nestin (1:1000) (Chemicon, Temecula, USA), mouse anti-βIII tubulin (1:500) (Promega, Madison, USA), rabbit anti Neurofilament 200kDa (1:500) (Chemicon), mouse anti-Map2ab (1:250) (Sigma–Aldrich, Taufkirchen, Germany), rabbit anti-GFAP (1:1000) (Dako, Hamburg, Germany) diluted in FSGB were added and cells were incubated at 4°C overnight. After washing with FSGB, cells were incubated with the secondary antibody (Alexa Fluor 488 conjugated donkey anti-rabbit antibody (Invitrogen) or Alexa Fluor 488 conjugated donkey anti-mouse antibody (Invitrogen)) diluted in FSGB for 2h. Cells were washed with TBS and incubated with 0.25μg/ml DAPI diluted in TBS for 15min. Before mounting with Prolong Antifade reagent (Invitrogen Molecular Probes, Oregon, USA), cells were washed again with TBS. Primary antibody was omitted in the negative control.

2.6 Reverse transcription polymerase chain reaction (RT)-PCR and real-time RT-PCR

For RNA isolation, mDFPCs and mRPCs were used and processed according to the manual of the RNA isolation kit NucleoSpin RNA II (Macherey-Nagel, Düren, Germany). The RevertAid First strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany) was used for a reverse transcription of total RNA into cDNA. The reaction was performed as stated in the manual, using 500ng RNA. For the polymerase chain reaction (PCR), GoTaq Green Master Mix kit (Promega, USA) was used. The PCR was repeated 35 times for target genes and 25 times for the housekeeper GAPDH. PCR primers and annealing temperatures are listed in Table 1.


Table 1.

Primers for RT-PCR and real-time RT-PCR.

GenPrimerSequenceAnneal temp.Roche Probe #
Sox2ForwardGTGGAAACTTTTGTCCGAGAC58°C
ReverseTGGAGTGGGAGGAAGAGGTAAC°°
Pax6ForwardAGTTCTTCGCAACCTGGCTA57 °C
ReverseTGAAGCTGCTGCTGATAGGA°°
NestinForwardAATGGGAGGATGGAGAATGGAC57 °C
ReverseTAGACAGGCAGGGCTAAGCAAG°°
Notch1ForwardTGCCTGTGCACACCATCCTGC57 °C
ReverseCAATCAGAGATGTTGGAATGC°°
Ki67ForwardGAGCAGTTACAGGGAACCGAAG58 °C
ReverseCCTACTTTGGGTGAAGAGGCTG°°
SnailForwardCCCACTCGGATGTGAAGAGATACC57 °C
ReverseATGTGTCCAGTAACCACCCTGCTG°°
Collagen IForwardGAGCGGAGAGTACTGGATCG55 °C
ReverseGCTTCTTTTCCTTGGGGTTC°°
Sox 9ForwardCGCCCATCACCCGCTCGCAATACG57 °C
ReverseAAGCCCCTCCTCGCTGATACTGG°°
OsteocalcinForwardTGACAAAGCCTTCATGTCCA57 °C
ReverseTGCCAGAGTTTGGCTTTAGG°°
VimentinForwardATGCTTCTCTGGCACGTCTT64 °C
ReverseAGCCACGCTTTCATACTGCT°°
GapdhForwardGACCACAGTCCATGCCATCAC57 °C
ReverseTCCACCACCCTGTTGCTGTAG°°
RhoForwardACCTGGATCATGGCGTTG60 °C#32
ReverseTGCCCTCAGGGATGTACC°°
GFAPForwardACAGACTTTCTCCAACCTCCAG60 °C#49
ReverseCCTTCTGACACGGATTTGGT°°
Tubb3ForwardGCGCATCAGCGTATACTACAA60 °C#104
ReverseTTCCAAGTCCACCAGAATGG°°
NFForwardACCACGACCTCAGCAGCTA60 °C#42
ReverseGGTTCCCCGAAGTTCATTTT°°
GusbForwardGTGGGCATTGTGCTACCTC60 °C#25
ReverseATTTTTGTCCCGGCGAAC°°


The 7900 HT Fast Real-Time PCR System (Applied Biosystems, Foster City, USA) was used for real-time RT-PCR. Primers and the corresponding probes (Universal ProbeLibrary Roche) are also listed in Table 1. Samples were measured in duplicates and gene expression of a housekeeper gene, glucuronidase beta (GusB), was used for normalization. For relative quantification of gene expression, the ΔΔCt calculation method was used (Winer et al., 1999). The gene expression of undifferentiated mRPCs was used for calibration (relative gene expression=1).

3 Results

3.1 Isolation of murine dental follicle cells and murine retinal progenitor cells

Isolated mDFPCs were successfully grown for >15 passages (Fig. 1A). For characterization of mDFPCs as osteoprogenitor cells, mDFPCs successfully differentiated into osteoblast/cementoblast-like cells, shown by calcium accumulation (Fig. 1B). Undifferentiated mDFPCs expressed the neural crest cell associated transcription factors Sox9 and Snail (Fig. 1C). The expression of the intermediate filament, vimentin, and the osteoblast marker, osteocalcin, also expressed in human dental follicle cells, were detected in mDFPCs (Morsczeck et al., 2005). Moreover, mDFPCs showed a strong expression of Collagen type I, typical for dental follicle cells (Hou et al., 1999). Both cell lines expressed Notch1, seen as a marker for dental follicle cells (Morsczeck et al., 2005) (Fig. 1C). These 2 cell lines of mDFPCs proliferated well under in vitro conditions without immortalization.

mRPCs were cultivated as adherent monolayer cultures as previously described (Angenieux et al., 2006). Isolated cells could be grown for >18 passages (Fig. 1D) and expressed the intermediate filament, nestin, that was validated by immunocytochemistry and RT-PCR (Fig. 1E and F). Retinal progenitor cells are also characterized by the expression of a marker for undifferentiated retinal cells, Pax6 (Fig. 1F). The expression of both, the multilineage progenitor marker, nestin, and the cell proliferation marker, Ki67, is characteristic for RPCs in an undifferentiated state (Tomita et al., 2006). In all 4 isolated mRPC cell lines, the expression of these RPC markers and of the neural stem cell marker, Sox2, was confirmed by RT-PCR (Fig. 1F).

3.2 Neural differentiation of mDFPCs and mRPCs

To test the differentiation potential of mDFPCs into neurons, cells were grown under neural differentiation conditions. For control we also attempted to differentiate mRPCs. Subsequent immunocytochemical analyses were used to assess the success of the induction of differentiation into neural cells or glial cells. Cell markers for neural cells were expressed in differentiated mDFPCs and mRPCs (Figs. 2 and 3). In contrast to mDFPCs, many differentiated mRPCs expressed high levels of the glial cell marker, GFAP (Figs. 2J and 3A,B). Real-time RT-PCR analysis and immunocytochemical analysis showed that only 5% of the differentiated mDFPCs expressed low levels of GFAP after differentiation (Fig. 3B). However, long-term cultivation of mDFPCs in neural differentiation medium reduced the viability of cells (data not shown). Differentiated mRPCs were utilized for a comparison of cell morphology and gene expression of neural differentiated cells. An immunocytochemical characterization of differentiated mDFPCs depicted the expression of β-III tubulin and a strong neural phenotype with long/branching neuritis of these cells similar to differentiated mRPCs (Fig. 2C and D). The differentiation of mRPCs caused an increased gene expression of β-III tubulin, neurofilament and rhodopsin that could be estimated by real-time PCR. Interestingly, all investigated marker genes were also expressed in differentiated mDFPCs (Fig. 3B). Here, gene expression levels of β-III tubulin, neurofilament and rhodopsin were similar or slightly lower than in differentiated mRPCs, but higher than in undifferentiated mRPCs.

4 Discussion

The aim of this study was to assess the ability of mDFPCs to differentiate into neurons under in vitro conditions. The dental follicle is an ectomesenchymal tissue, and dental follicle cells could be isolated from mice, as shown before (Luan et al., 2006; Yokoi et al., 2007). In contrast to these studies, however, we isolated dental follicle precursor cells which had not been immortalized. Moreover, mDFPCs have a flattened shaped cell morphology that is different from immortalized cells isolated previously by Luan et al. (2006). We used a special cell culture medium for the cultivation of mDFPCs, which enabled proliferation of dental follicle cells under in vitro conditions for >15 passages and we could use these cells without further manipulation for our experiments. The identity of the isolated cells was verified by the expression of several characteristic marker genes. Amongst others, mDFPCs were positive for markers of the neural crest, which is the origin of dental follicle cells (Kemoun et al., 2007; Ten Cate, 1997). Furthermore, mDFPCs were able to differentiate into osteoblast/cementoblast-like cells, which is characteristic of dental follicle cells (Morsczeck et al., 2005; Yokoi et al., 2007).

As a control, we additionally isolated and differentiated mRPCs. Angenieux et al. (2006) claimed that the peak of photoreceptor production in the retina is reached in the first postnatal days. This suggests that the retina contains highly proliferative cells at this time, and therefore RPCs were extracted at postnatal day 0. Cell morphology and nestin expression of our mRPCs was similar to mRPCs that were extracted and expanded previously by Angenieux et al. (2006).

The differentiation media and protocols used in our study are modified from previous studies on neural differentiation of adult stem cells (Angenieux et al., 2006; Widera et al., 2007). All-trans-retinoic acid is a retinoid that induces neural commitment and is frequently used for retinal and neural differentiation of neural stem cells and retinal progenitor cells (Djojosubroto and Arsenijevic, 2008; Kaneko et al., 2003; Qiu et al., 2005). Since a retinoic acid concentration of 0.5μM yields the most differentiated neural cells (Kelley et al., 1994), we used this concentration for differentiation of mRPCs. Our protocol, containing 5μM retinoic acid, upregulated neural cell markers in mDFPCs. This same concentration was also used previously for neural differentiation of periodontally-derived stem cells (Widera et al., 2007). Interestingly, it was a toxic concentration for mRPCs in our study (data not shown).

We observed that a high percentage of differentiated mRPCs expressed marker for glial cells, similar results being found with rat RPCs (Engelhardt et al., 2004). The morphology of differentiated mDFPCs was neuron-like, whereas culturing according to a differentiation protocol with 0.5μM retinoic acid resulted in an undifferentiated mDFPC cell morphology (data not shown). Differentiation of mRPCs served as a control to evaluate the differentiation potential of mDFPCs toward neurons. In contrast to BMSCs, differentiated mDFPCs expressed not only neural cell markers but also transcripts for rhodoposin (Tomita et al., 2006). In summary, the neural differentiation potential of mDFPCs is remarkable, although mRPCs demonstrated a more complete neural differentiation. However, real-time RT-PCRs showed that expression levels of investigated cell markers were slightly lower than in differentiated mRPCs. This was also seen by the intensity of immunofluorescence, which was stronger in differentiated mRPCs. In contrast, more mDFPCs express neural cell markers after differentiation.

Similar to mDFPCs, rat dental follicle cells differentiated in neuron-like cells expressing the late neural cell marker neurofilament (Yao et al., 2008). Moreover, Arthur et al. (2008) described neural differentiation of dental pulp stem cells. Here, cells express also the late neural cell marker neurofilament and exhibited the capacity to produce a sodium current consistent with functional neuronal cells when exposed to neuronal inducing media. However, both these groups did not investigate the expression of glial cell markers. In contrast, Widera et al. (2007) could isolate periodontal ligament-derived neural stem cells and get them to differentiate into a glial morphology with a high expression of GFAP. This result suggests that dental stem cells can also differentiate into glial cells.

This is the first isolation of mDFPCs without cell immortalization. Furthermore, we have demonstrated that mDFPCs can differentiate into neural-like cells under in vitro conditions. Further studies about signaling and molecular mechanisms during neural differentiation are needed to improve the neural differentiation protocol of mDFPCs. Little differentiation of mDFPCs into glial cells is seen with our current protocol. However, mDFPCs are excellent for studies on cell-based therapies in animal models of dental or neural degeneration.

Acknowledgements

We thank Dr Merle Windgassen-Morsczeck for reading the manuscript and offering valuable suggestions. This work was supported by the Deutsche Gesellschaft für Zahn-, Mund- und Kieferheilkunde (DGZMK).

References

Angenieux B, Schorderet, DF, Arsenijevic, Y. Epidermal growth factor is a neuronal differentiation factor for retinal stem cells in vitro. Stem Cells 2006:24:696-706
Crossref   Medline   1st Citation   2nd   3rd   4th   5th  

Arthur A, Rychkov, G, Shi, S, Koblar, SA, Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells 2008:26:1787-95
Crossref   Medline   1st Citation   2nd  

Canola K, Angenieux, B, Tekaya, M, Quiambao, A, Naash, MI, Munier, FL. Retinal stem cells transplanted into models of late stages of retinitis pigmentosa preferentially adopt a glial or a retinal ganglion cell fate. Invest Ophthalmol Vis Sci 2007:48:446-54
Crossref   Medline   1st Citation  

Djojosubroto MW, Arsenijevic, Y. Retinal stem cells: promising candidates for retina transplantation. Cell Tissue Res 2008:331:347-57
Crossref   Medline   1st Citation  

Engelhardt M, Wachs, FP, Couillard-Despres, S, Aigner, L. The neurogenic competence of progenitors from the postnatal rat retina in vitro. Exp Eye Res 2004:78:1025-36
Crossref   Medline   1st Citation   2nd  

Hou LT, Liu, CM, Chen, YJ, Wong, MY, Chen, KC, Chen, J. Characterization of dental follicle cells in developing mouse molar. Arch Oral Biol 1999:44:759-70
Crossref   Medline   1st Citation  

Kaneko Y, Ichikawa, M, Kurimoto, Y, Ohta, K, Yoshimura, N. Neuronal differentiation of hippocampus-derived neural stem cells cultured in conditioned medium of embryonic rat retina. Ophthalmic Res 2003:35:268-75
Crossref   Medline   1st Citation  

Kelley MW, Turner, JK, Reh, TA. Retinoic acid promotes differentiation of photoreceptors in vitro. Development 1994:120:2091-102
Medline   1st Citation  

Kemoun P, Laurencin-Dalicieux, S, Rue, J, Farges, JC, Gennero, I, Conte-Auriol, F. Human dental follicle cells acquire cementoblast features under stimulation by BMP-2/-7 and enamel matrix derivatives (EMD) in vitro. Cell Tissue Res 2007:329:283-94
Crossref   Medline   1st Citation  

Klassen H, Kiilgaard, JF, Zahir, T, Ziaeian, B, Kirov, I, Scherfig, E. Progenitor cells from the porcine neural retina express photoreceptor markers after transplantation to the subretinal space of allorecipients. Stem Cells 2007:25:1222-30
Crossref   Medline   1st Citation  

Lasky JL, Wu, H. Notch signaling, brain development, and human disease. Pediatr Res 2005:57:104R-9R
Crossref   Medline   1st Citation  

Luan X, Ito, Y, Dangaria, S, Diekwisch, TG. Dental follicle progenitor cell heterogeneity in the developing mouse periodontium. Stem Cells Dev 2006:15:595-608
Crossref   Medline   1st Citation   2nd   3rd  

Lumsden AG. Spatial organization of the epithelium and the role of neural crest cells in the initiation of the mammalian tooth germ. Development 1988:103:Suppl:155-69
Medline   1st Citation  

MaClaren RE, Pearson, RA, MacNeil, A, Douglas, RH, Salt, TE, Akimoto, M. Retinal repair by transplantation of photoreceptor precursors. Nature 2006:444:203-7
Crossref   Medline   1st Citation  

Miura M, Gronthos, S, Zhao, M, Lu, B, Fisher, LW, Robey, PG. SHED: stem cells from human exfoliated deciduous teeth. Proc Natl Acad Sci U S A 2003:100:5807-12
Crossref   Medline   1st Citation   2nd  

Modino SA, Sharpe, PT. Tissue engineering of teeth using adult stem cells. Arch Oral Biol 2005:50:255-8
Crossref   Medline   1st Citation  

Morsczeck C, Gotz, W, Schierholz, J, Zeilhofer, F, Kuhn, U, Mohl, C. Isolation of precursor cells (PCs) from human dental follicle of wisdom teeth. Matrix Biol 2005:24:155-65
Crossref   Medline   1st Citation   2nd   3rd   4th   5th   6th   7th  

Pardal R, Ortega-Saenz, P, Duran, R, Lopez-Barneo, J. Glia-like stem cells sustain physiologic neurogenesis in the adult mammalian carotid body. Cell 2007:131:364-77
Crossref   Medline   1st Citation  

Qiu G, Seiler, MJ, Mui, C, Arai, S, Aramant, RB, de Juan, E. Photoreceptor differentiation and integration of retinal progenitor cells transplanted into transgenic rats. Exp Eye Res 2005:80:515-25
Crossref   Medline   1st Citation  

Ten Cate AR. The development of the periodontium–a largely ectomesenchymally derived unit. Periodontol 2000 1997:13:9-19
Crossref   Medline   1st Citation  

Tomita M, Mori, T, Maruyama, K, Zahir, T, Ward, M, Umezawa, A. A comparison of neural differentiation and retinal transplantation with bone marrow-derived cells and retinal progenitor cells. Stem Cells 2006:24:2270-8
Crossref   Medline   1st Citation   2nd   3rd  

Tropepe V, Coles, BL, Chiasson, BJ, Horsford, DJ, Elia, AJ, McInnes, RR. Retinal stem cells in the adult mammalian eye. Science 2000:287:2032-6
Crossref   Medline   1st Citation  

Widera D, Grimm, WD, Moebius, JM, Mikenberg, I, Piechaczek, C, Gassmann, G. Highly efficient neural differentiation of human somatic stem cells, isolated by minimally invasive periodontal surgery. Stem Cells Dev 2007:16:447-60
Crossref   Medline   1st Citation   2nd   3rd   4th  

Winer J, Jung, CK, Shackel, I, Williams, PM. Development and validation of real-time quantitative reverse transcriptase–polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal Biochem 1999:270:41-9
Crossref   Medline   1st Citation  

Yao S, Pan, F, Prpic, V, Wise, GE. Differentiation of stem cells in the dental follicle. J Dent Res 2008:87:767-71
Crossref   Medline   1st Citation   2nd  

Yokoi T, Saito, M, Kiyono, T, Iseki, S, Kosaka, K, Nishida, E. Establishment of immortalized dental follicle cells for generating periodontal ligament in vivo. Cell Tissue Res 2007:327:301-11
Crossref   Medline   1st Citation   2nd  


Received 5 January 2009/18 March 2009; accepted 14 April 2009

doi:10.1016/j.cellbi.2009.04.005


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)