Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2009) 33, 830–838 (Printed in Great Britain)
Clinical grade mesenchymal stem cells transdifferentiated under xenofree conditions alleviates motor deficiencies in a rat model of Parkinson's disease
Prathibha Shettya*, Geeta Ravindrana, Shabari Saranga, Anirbhan M. Thakurb, Harinarayana S. Raob and Chandra Viswanathana
aRegenerative Medicine, Haematopoietic Stem Cell Group
bLaboratory Animal Research Services, Reliance Life Sciences Pvt Ltd, Dhirubhai Ambani Life Sciences Centre, R-282 TTC Area of MIDC, Thane Belapur Road, Rabale, Navi Mumbai 400701, India


Abstract

Bone marrow derived mesenchymal stem cells (BMMSCs) is a valid, definitive candidate for repair of damaged tissues in degenerative disorders in general and neurological diseases in particular. We have standardized the processing conditions for proliferation of BMMSCs using xenofree medium and checked their in vitro and in vivo neurogenic potential.


Keywords: Bone marrow, Clinical grade mesenchymal stem cells (MSCs), Cord blood serum (CBS), Dopaminergic neurons, 6-Hydroxydopamine (6-OHDA), Parkinson's disease (PD).

*Corresponding author. Tel.: +91 22 6767 8436; fax: +91 22 6767 8099.


1 Introduction

Amongst neurological conditions, PD is a chronic, progressive neurodegenerative movement disorder. Tremors, rigidity, slow movement (bradykinesia), poor balance, and difficulty in walking (called Parkinsonian gait) are major characteristic symptoms of the disease. Approximately 5–6 million people are affected globally. The prevalence varies widely from 82 per 100,000 in Japan and 108 per 100,000 in UK, to nearly 1% (approximately 1 million) of the North American population. In India, however, the prevalence rate of Parkinson's disease is highest in the Parsi community in Western India. (363 per 100,000) followed by other parts of the country which is 14 per 100,000 in North India, 27 per 100,000 in South India, 16 per 100,000 in East India.

Parkinson's disease results from the degeneration of dopamine-producing nerve cells in the brain, specifically in the substantia nigra and the locus coeruleus. l-dihydroxyphenylalanine (L-DOPA) can attenuate the motor dysfunctions associated with the disease, but long-term efficacy of this treatment gradually decreases over time with multiple side effects. Cell replacement therapy to restore the degenerated dopaminergic neurons may serve as a viable alternative to achieve significant clinical improvement. Cell-based therapies derived from fetal or embryonic origin have been tested with questionable success. Yet, technical, ethical, practical, limited availability, and variable outcome continue to be a researcher's nightmare (Freed et al., 2001).

Under these circumstances, adult stem cells could be an ideal source for replacement therapy due to their self-renewal and multilineage developmental potential. Because of their unique attributes of plasticity and accessibility, BMMSCs are a definite alternative to neuronal tissue or embryonic cells in replacing autologous damaged tissues for several neurodegenerative diseases. By harnessing the neuronal potential of readily available and accessible adult bone marrow cells, substantial ethical and technical dilemmas may be circumvented.

Recent studies have shown that BMMSCs improve neurological deficits when transplanted into animal models of neurological disorders. The transdifferentiation potential of MSCs into neurons in vitro has been reported earlier (Cho et al., 2005). Cytokines, growth factors, neurotrophins, and retinoic acid have been used to promote neural cell induction and differentiation both in vivo and in vitro (Inna et al., 2007; Choi et al., 2006; El-Badri et al., 2006; Krampera et al., 2007). Earlier reports have shown the usage of chemicals in both rodent and human MSCs for neuronal differentiation in vitro (Woodbury et al., 2000; Karen et al., 2004; Chen et al., 2006). The induced cells exhibited a neuronal morphology and expressed several neuronal markers like NSE (neuron specific enolase), Neurofilament-M, tau, and NeuN.

In our earlier publication, we have reported that culturing of MSCs isolated from human bone marrow aspirate in the presence of human umbilical cord blood serum instead of FBS gives more effective expansion and also retains their differentiation capability.

We now show that BMMSCs cultured under xenofree conditions continue to maintain the mesenchymal surface marker expression and display the typical mesenchymal phenotype CD73+/CD105+/CD44+/CD29+/SSEA4+/CD45−/CD31−/vWF−/CD14−. We could induce efficient differentiation of these cells into dopaminergic neurons in vitro in the presence of neurotrophic factors and chemical inducers such as DMSO/BHA (Butylated Hydroxy Anisole). Furthermore, the therapeutic potential of expanded MSCs in vivo were assessed by transplanting the cells into the brains of Parkinson's disease models in an attempt to correct the dopamine deficiency that affects the motor function.

Herein we will report that BMMSCs expanded under xenofree conditions and processed under an cGMP-compliant environment differentiate into functional neurons. This ability has been demonstrated by a significant behavioural improvement in Parkinsonian rats. In consequence, survival, engraftment and differentiation post transplantation into dopaminergic neurons was confirmed by histology.

2 Materials and methods

2.1 Isolation and expansion of BMMSCs in the presence of CBS

Normal human bone marrow aspirate was processed in a clean room environment which was obtained after approval from the Institutional Committee for Stem Cell Research and Therapy (IC-SCRT) and in accordance with the terms of the ethics committee of the institute. Mononuclear cells (MNCs) were isolated as before (Shetty et al., 2007). Isolated cells were seeded in 75-cm2 tissue culture flasks (Nunc, New York, USA) in MSC proliferation medium containing DMEM: F12 (1:1) (Invitrogen, Chromos, Singapore) supplemented with 10% CBS and 1ng/ml of basic fibroblast growth factor (Sigma, MO, USA), incubated at 37°C with 5% CO2. The cells grew as colonies which then became confluent to form a monolayer. Upon reaching confluence, the cells were harvested using trypsin EDTA (Invitrogen, Chromos, Singapore) to give a single cell suspension. The harvested cells were analyzed for cell surface markers by flow cytometry (BD Pharmingen, CA, USA).

2.2 Identification of BMMSC phenotype

Immunophenotyping of the cultured MSCs were done using flow cytometry. The adherent cells were washed with PBS and detached by incubating with 0.05% trypsin EDTA (Invitrogen, Chromos, Singapore) for 5min at 37°C. The harvested cells were washed using staining buffer containing 4% FBS and 0.1% azide in PBS. After washing count was taken and &007E;50,000 cells were used for cell surface antigen expression studies. Cells were incubated with CD45 PerCP (BD Pharmingen, CA USA), CD73 PE (BD Pharmingen, CA, USA), CD105 PE (Caltag, CA, USA), SSEA4 PE (R&D systems, MN, USA), CD14 PE (BD Pharmingen, CA, USA), CD31 PE (BD Pharmingen, CA, USA), CD29 (BD Pharmingen, CA USA), CD44 (BD Pharmingen, CA, USA), vWF (BD Pharmingen, CA, USA), using standard techniques (Tanavde et al., 2002). Goat antimouse FITC was used as secondary antibody to detect the vWF primary antibody. Appropriate isotype controls were used. These cells were examined with a FACS Calibur Flow Cytometer (BD, CA, USA) equipped with a 488nm Argon Laser. Approximately 10,000 events were acquired and analyzed using Cell Quest Software. For viability determination, cells were stained with 7-Aminoactinomycin D (7-AAD), (BD Pharmingen, CA, USA) and subject to flow cytometery. Dead cells take up the fluorescent stain while live cells exclude this stain. Viability and surface antigen expression were evaluated at every passage.

2.3 Neural differentiation of BMMSCs cultured in CBS

To induce neuronal differentiation, a modified version of Woodbury et al., protocol was followed. Briefly, after 3 days of expansion in MSC proliferation medium, the MSCs were pre-induced in DMEM: F12 (1:1) medium (Invitrogen, Chromos, Singapore) containing10% CBS, 2% B27 (Invitrogen, Chromos, Singapore) and supplemented with growth factors – 2ng/ml basic fibroblast growth factor (Sigma, MO, USA), 100ng/ml nerve growth factor (Sigma, MO, USA), 50ng/ml of Noggin (Peprotech, NJ, USA). The cells were maintained in neuronal pre-induction medium for a week with media changes done on alternate day. After a week, the cells were induced with 200μM BHA (Sigma, MO, USA) in the same media for 4–5h to adapt the dopaminergic fate. Differentiated cells were characterized for the expression of neuron specific markers by immunoflourescence and RT-PCR. For characterization studies, the expanded cells were plated in 8-well chamber slides (BD Falcon, CA, USA) at 3000 cells per well. The expanded BMMSCs were also seeded in 35mm Petri dishes at a density of 3000 cells per plate for RT-PCR and in vivo transplantation studies in animal models. Controls included cells which were cultured in MSC proliferation medium for a week.

2.4 Immunofluorescence studies

To confirm that MSCs differentiated into neuronal lineage, the protein markers expressed by the differentiated cells were identified by immunoflourescence. After 4–5h of induction with BHA in neuronal media, the cells grown on 8-well chamber slides were washed with 1× PBS and fixed in 4% paraformaldehyde at 4°C for 30min. The cells were rinsed with PBS and stained with neuronal markers. The differentiated cells were checked for expression of the following antibodies: Nestin (1:200), Neuronal specific nuclear protein (NeuN, 1:200), Neurofilament-70 (NF-70, 1:100), β tubulin (1:100), and tyrosine hydroxylase (TH, 1:100). All the primary antibodies were procured from Chemicon, CA, USA. The primary antibodies were diluted in staining buffer consisting of 0.1% Triton X-100 in PBS. The cells were incubated overnight at 4°C with primary antibody. After washing 3 times with PBS, cells were incubated with goat anti-mouse Alexa 488 (1:500) (Molecular probes, Oregon, USA) as a secondary antibody for 30min at 37°C and counterstained with DAPI (1μg/ml), (Sigma, MO, USA). Immunopositive areas sought by fluorescence microscopy (Nikon Eclipse E600).

2.5 Gene expression studies by RT-PCR

The cell pellets of both induced and uninduced cells were used for total RNA extraction. Total RNA was isolated from 1×106 cells by Trizol method. (Invitrogen, Chromos, Singapore). 5μg of RNA was used for cDNA synthesis. The cDNA was synthesized using Superscript reverse-transcriptase II (Invitrogen, Chromos Singapore). One μl of cDNA was amplified by polymerase chain reaction using 2× PCR master mix (ABgene, Surrey, UK), with appropriate primers. The list of primers is given in Table 1. Cycling parameters were as follows: Initial denaturation at 94°C for 2min, denaturation at 94°C for 30s, annealing at 55–65°C for 30s depending on the primer, and elongation for 1min, with the number of cycles varying between 25 and 40. Final elongation was carried out at 72°C for 7min.


Table 1.

Primer sequences used for polymerase chain reactions.

GeneForwardReverseAnnealing tempSize (bp)
GAPDHTGAAGGTCGGAGTCAACGGATTTGGCATGTGGGCCATGAGGTCCACCAC60 °C890
NanogCCT CCT CCA TGG ATC TGC TTA TTC ACAG GTC TTC ACC TGT TTG TAG CTG AG52 °C262
OCT4CGRGAAGCTGGAGAAGGAGAAGCTGCAAGGGCCGCAGCTTACACATGTTC58 °C247
NestinTTTTCCACTCCAGCCATCCCCAGAAACTCAAGCACCAC58 °C395
β TubulinCTTACTACTGTTAGATCCCAGGAATTGAGACGATGTCCTCCATA56 °C240
THTCATCACCTGGTCACCAAGTTGGTCGCCGTGCCTGTACT62 °C107
Nurr1CGGACAGCAGTCCTCCATTAAGGTCTGAAATCGGCAGTACTGACAGCG68 °C790
NF-MGAG CGC AAA GAC TAC CTG AAG ACAG CGA TTT CTA ATC CAG AGC C63 °C430


2.6 Dopamine measurement by HPLC

The functional capacity of both induced and control BMMSCs was measured by the release of dopamine into the culture medium after 1 week of differentiation (48h after the last medium change) by Reverse phase-HPLC. Culture medium from undifferentiated cells and 1 week post-differentiation was immediately stabilized after collection with 7.5% orthophosphoric acid/metabisulphite (0.22mg/ml) and stored at 80°C until analysis. The mobile phase consisted of sodium acetate (0.2M), EDTA (0.2mM), heptane sulfonic acid (0.55%), dibutylamine (0.01%) and methanol (16%). The pH was adjusted to 3.92 with orthophosphoric acid. Samples (100μl) were separated on reverse phase nucleosil C18 column and detected with an electrochemical detector. The mobile phase was pumped at a flow rate of 0.5ml/min. Dopamine levels were calculated using external reference dopamine standards injected immediately before and after each experiment.

2.7 Creation of PD rat model

The rat model of PD was Ravindran and Rao (2006). Briefly, adult male Sprague Dawley rats weighing about 180–250g (n=25) were anesthetized with ketamine (50mg/kg i.p) and valium (30mg/kg i.p) and fixed in a stereotaxic frame (Stoelting Co. USA). Ten microlitres of 6-hydroxydopamine (6-OHDA; Sigma, MO, USA) at 6mg/ml were injected using a motorized microinjector at 1ul/min, lowered into the substantia nigra using stereotaxic-guided coordinates [from Bregma posterior 4.5mm, left 2.2mm, and ventral 7.8mm]. Four to 6 weeks after 6-OHDA treatment, animals were examined for rotational symmetry after i.p. injection of 3mg/kg of apomorphine hydrochloride (Sigma, MO, USA). Rats showing ≥10 rotations per min over a 1h interval were selected and randomly assigned to treatment or control groups. To prevent subjective bias, a trained examiner who was unaware of the experimental details evaluated the rats. All animal studies were performed in accordance with the Committee for the Purpose of Control and Supervision of Experimental Animals (CPCSEA) guidelines and were approved by our Institutional Animal Ethics Committee.

2.8 Transplantation of BMMSCs cultured in xenofree media

The 6-OHDA treated rats that showed significant ipsilateral turning response were selected for the study. The rats (n=12) were used for cell transplantation. Each rat was anesthetized with ketamine (50mg/kg i.p) and valium (30mg/kg i.p), fixed in a stereotaxic frame (Stoelting Co. USA) and received an injection through a 28-gauge needle into the substantia nigra of 0.2–0.3 million undifferentiated BMMSCs suspended in 12μl of medium at the rate of 2μl/min. All the cells injected were labeled with cell tracker dye DiI (Molecular Probes, Oregon, USA) prior to transplantation. Sham-injected control rats (n=6) underwent the same procedure except that they received only medium.

The severity of the disease and the extent of recovery were assessed in sham-injected and cell transplanted animals by physical activity and behavioural responses. Rotations were counted for 1h after subcutaneous injection of apomorphine hydrochloride (Sigma, MO, USA). At the end of 3 months, all the animals were assessed by apomorphine-induced rotations and histology studies.

2.9 Immunohistochemical analysis of PD brain post transplantation

At 12 weeks post-transplantation, rats were anesthetized with ketamine (50mg/kg i.p) and valium (30mg/kg i.p), and perfused with saline followed with 4% paraformaldehyde. The brains were equilibrated in 20% sucrose in PBS overnight at room temperature. They were processed to obtain thin paraffin sections of 4–10 micron for immunohistological studies. The sections were deparaffinized with xylene and ethanol treatments, followed by a subsequent antigen retrieval by dipping the slides in citrate buffer. The slides were heated in a microwave for 30s and permeabilized with 0.2% Triton X-100 in PBS. The non-specific binding slides were blocked with 1% BSA in PBS. The sections were incubated overnight at 4°C with anti-TH and anti-human nuclei (Chemicon, CA, USA) antibodies along with negative controls. The sections were washed with PBS and incubated with the appropriate secondary antibody conjugate. To confirm the presence of transplanted TH positive cells, co-localization with anti-human nuclei was done. The sections were embedded in immunoflour mounting medium and observed under a fluorescence microscope (Nikon Eclipse E600) for immunopositive cells.

3 Results

3.1 Expansion and characterization of BMMSCs cultured in medium containing CBS

MSCs obtained from human bone marrow were successfully cultured and expanded in medium containing CBS under cGMP conditions. MSCs isolated from bone marrow grew as distinct colonies within 1 week of culture after which the colonies started expanding and formed a monolayer of adherent fibroblast like cells. MSCs cultured in CBS showed an 8–10 fold increase in expansion at every passage (Fig. 1). Furthermore, the results from flow cytometry indicated that expanded BMMSCs were positive for mesenchymal markers such as CD73, CD105, CD44, CD29, but negative for haematopoietic and endothelial markers such as CD45, CD14, CD31, vWF (Fig. 2). These cells showed 90% purity in terms of MSC antigen expression and viability expressing a phenotype of CD73+/CD105+/CD44+/CD29+/SSEA4+/CD45−/CD31−/CD14−/vWF (Fig. 2).


Fig. 1

(a) Growth kinetics of the BMMSCs expanded in a xenofree media. BMMSC showed an 8–10 fold increase in the cell count after expansion at every passage in presence of CBS for a week. The cells could be expanded for 5 passages. (b) Bar graph showing the viability of the expanded BMMSCs. The viability of the cells expanded in CBS were determined at every passage and these cells were more than 90% viable as checked by 7-aminoactinomycin D (7-AAD) on flow cytometry.


Fig. 2

Immunophenotyping of the BMMSCs expanded in xenofree media by flow cytometry. BMMSCs expanded in CBS media were checked for the cell surface antigen expression for various mesenchymal and haematopoietic markers. The expanded BMMSCs were negative for haematopoietic marker and strongly expressed mesenchymal markers. The phenotype expressed by the expanded cells was CD73+/CD105+/CD29+/CD44+/SSEA4+/CD45−/CD14−/CD31−/vWF−.



3.2 Neuronal differentiation and characterization

Neuronal differentiation was initiated by culturing the undifferentiated BMMSCs in neuronal pre-induction medium containing neurotropic factors and CBS. After 1 week in neuronal induction medium, the cytoplasm of the fibroblast like cells retracted towards the nucleus (Fig. 3a and b). Upon exposure to strong neural inducers, such as DMSO/BHA, most cells had a neuronal morphology including a small cell body and long processes (Fig. 3c and d). To confirm that BMMSCs differentiated along neuronal lineages, we examined the expression of specific markers in the cells by immunoflourescence and RT-PCR. Immunoflourescence analysis demonstrated that the differentiated cells expressed neuronal specific surface markers such as NF-70 (Fig. 4c), NeuN (Fig. 4d), and TH (Fig. 4e). Undifferentiated BMMSCs expressed Nestin (Fig. 4a) and β tubulin (Fig. 4b) which was confirmed by gene expression studies indicating a neuronal predisposition. RT-PCR showed the expression of characteristic neuronal markers Nestin, β tubulin, NFM, and dopaminergic markers TH, Nurr1 (Fig. 5). Undifferentiated BMMSCs also expressed Nanog, which is expressed by stem cells (Fig. 5). In measuring the in vitro functional properties of differentiated BMMSCs by RP-HPLC we found that a detectable level of dopamine (1.93ng/ml) was secreted by the differentiated neurons into the culture medium compared to undifferentiated BMMSCs (Fig. 6).


Fig. 3

Neuronal differentiation of BMMSCs in xenofree media. (a) BMMSCs expanded in xenofree medium grow as monolayer. These undifferentiated cells show a uniform fibroblast-like morphology, being spindle shaped. (b) On exposure to neuronal induction medium in a xenofree media, the expanded BMMSCs show a change in morphology which begins within 4h of induction. (c) After 4h of induction, the cytoplasm of the BMMSCs retracts and the cells start acquiring neuronal morphology with processes. Scale bars 50μm.


Fig. 4

Characterization of the neuronal differentiation of BMMSCs by immunoflourscence. Undifferentiated BMMSCs and differentiated BMMSCs were checked for neuron specific markers such as Nestin and β tubulin, Neurofilment-70 (NF-70), Neuron specific nuclear protein (NeuN), Tyrosine Hydroxylase (TH). Undifferentiated BMMSCs showed positive staining for Nestin (4a) and β tubulin (4b) and differentiated cells expressed neuronal specific markers such NF-70 (4c), NeuN (4d), TH (4e). Scale bars 50μm.


Fig. 5

Gene expression studies of neuron specific markers by Reverse Transcriptase PCR (RT-PCR). Undifferentiated (UD) and differentiated cells (D) were checked for neuron specific genes, with Ntera 2 cells as positive control. Undifferentiated cells expressed stem cell marker Nanog and neuron specific genes Nestin and β tubulin. The differentiated cells expressed neuronal and dopaminergic specific genes specific genes such as NFM and Nurr1, TH.


Fig. 6

Measurement of dopamine released into the culture supernatant. Samples were separated on reverse phase nucleosil C18 column and detected with an electrochemical detector. Dopamine levels were calculated using external dopamine standards injected immediately before and after each experiment. Concentration of dopamine released by differentiated BMMSCs was significantly higher (1.95ng/ml) compared to the undifferentiated BMMSCs (0.03ng/ml), as tabulated in the figure.





3.3 In vivo differentiation and functionality of BMMSCs post transplantation

With regard to in vivo survival, differentiation and functional abilities of the undifferentiated BMMSCs expanded under xenofree and cGMP conditions after transplantation into the substantia nigra of Parkinsonian rats, motor abnormality was tested with the rotational behaviour in response to apomorphine injection. No improvement occurred during first 2 weeks post-transplantation, but from 4 weeks onwards the PD rats showed a significant motor improvement and reduced apomorphine-induced rotations. After 12 weeks post-transplantation, the rate showed a significant reduction in apomorphine-induced rotations compared to the controls (Fig. 7). The histology of the grafted area showed that the transplanted cells survived in the substantia nigra and differentiated into dopaminergic neurons. In order to confirm that the transplanted cells were of human origin, double-labeling with human nuclei antibody and TH were done. At 12 weeks post-transplantation, DiI labeled cells were found along the injection tract and cells that stained with anti-human nuclei and TH were seen within the substantia nigra (Fig. 8), not seen in control animals which received only medium.


Fig. 7

Behavioural analysis of the PD animals injected with BMMSCs expanded in xenofree medium. The number of apomorphine-induced rotations per h was counted in the transplanted and non-transplanted animals. The graph compares the rotations in the transplanted and non-transplanted animals at 2, 4, 6, 8, 10 and12 weeks. Transplanted animals showed reduction in rotations from 4 weeks post-transplantation. The transplanted animals show continuous and significant improvement as the weeks progressed.


Fig. 8

Immunohistochemistry of brain sections of PD induced rats. Transverse section of the PD rat brain 12 weeks post transplantation shows positive staining for both TH (FITC) and human nuclei (Alexa 568) confirming the human origin of the transplanted cells as indicated by the arrows. Scale bars 50μm.



4 Discussion

Cell replacement therapy aims at grafting therapeutically appropriate cells to impaired tissues and has been proposed as future therapies for neurodegenerative disorders. It is well known that neurological diseases like Parkinson's disease are caused mainly due to the progressive loss of functional cells due to aging (Ran et al., 2006). Spontaneous neural tissue repair takes place in patients affected by inflammatory and degenerative disorders to a lesser or greater degree (Stefano et al., 2005). However, this process is not robust enough to promote a functional and long term remission.

MSCs are the most extensively studied adult stem cells with respect to transdifferentiation potential especially towards neuronal differentiation (Long et al., 2005). BMMSCs offer the best hope for autologous stem cell based replacement therapies because of their potency, accessibility and immunosuppressive properties.

They are a unique population of multipotent progenitor cells which can be obtained in quantities adequate for clinical applications, thus making them good candidates for use in tissue repair. There are many reports on the successful isolation and expansion of mesenchymal stem cells in culture, including our own earlier publication (Karen et al., 2004; Mark et al., 1999; Shetty et al., 2007).

Feasibility and safety of the application of BMMSC for clinical use propagated ex vivo in FBS containing cell cultures, has been documented in a significant number of studies over the last decade (Le Blanc and Ringden, 2006). However, the use of FBS during MSC propagation carries the risk of transmission of known and unknown pathogens as well as xenoimmunization, which is an important issue (Edwin et al., 2002; Carl et al., 2006).

Attempts have been made by several groups for replacing FBS with growth factors derived by mixing purified factors which are either isolated from FBS or a mixture of growth factors derived by recombinant methods. However, these culture media have their associated shortcomings and risks since they are unable to support MSC expansion beyond 2 passages (Meuleman et al., 2006). Use of autologous serum in the culture media is a better option for addressing this issue. Mizuno et al. (2006) used autologous human serum for expanding BMMSCs for 9 days, which gives limited expansion, not adequate enough for clinical use. This can still be considered a good option in certain limited clinical conditions but in a larger perspective of clinical conditions, obtaining autologous serum in adequate quantities will be a major challenge to the manufacturers. We need to bear in mind, the various limitations of the donors such as aging, disease conditions, logistics, etc., before we can see autologous serum being a better option.

The next best candidate is cord blood serum. In our earlier publication, we clearly showed the superiority of using cord blood serum as a xenofree alternative to FBS. We could expand MSC with no undesirable effect whatsoever on transdifferentiation and stability in cultures for >5 passages, and generate large quantities of BMMSCs that would meet the clinical requirements. Here, we have used CBS for expansion by approved and validated protocols. CBS is processed as per available regulatory guidelines in a controlled cGMP environment, using excipients that can satisfy quality parameters.

The in vitro experiments demonstrate the dopaminergic differentiation capabilities by BMMSCs cultured in CBS. This was confirmed by the expression of TH at the cellular and molecular level. The measurement of dopamine secreted in the culture medium confirms their functionality. In addition to TH, the differentiated cells were positive for other neuronal markersl, such as NeuN, NF-70 and β tubulin. The use of xenofree media matches well with the observations made by other investigators who worked on different cell types, including those from umbilical cord blood stem cells using conventional media (Sanchez-Ramos, 2002; Krampera et al., 2007). These undifferentiated BMMSCs showed a strong neuronal predisposition, seen in their gene expression, as previously reported (Tondreau et al., 2004; Deng et al., 2006). Furthermore, these cells were checked for functionality in animal models. The 6-OHDA lesioned PD rat model was created to assess the efficacy of differentiated cells. The animals started showing significant behavioural improvement post-transplantation, as assessed by apomorphine-induced rotations. Our results indicate that the BMMSCs cultured in CBS injected into a damaged area of the PD rat brain had engrafted and differentiated into functional dopaminergic neurons capable of secreting dopamine and alleviating behavioural deficiencies (Hellmann et al., 2006; Inna et al., 2007).

In summary, we have shown that BMMSCs are a good potential source of material for the treatment of PD. Since these cells have been grown in CBS, they address the issues raised by translational researchers and clinicians alike. Thus, their injection for clinical applications into humans can be considered. We therefore recommend a better and feasible source of serum (CBS), which not only allows expansion of BMMSCs, but also maintains and retains the potential for neuronal differentiation. This data will help in the field of regenerative medicine and cell therapy applications with MSCs. Until such time as a definitive modality of treatment becomes a common prescription for PD, undoubtedly researchers can go to the next step to initiate trials using autologously derived MSCs. These cells could treat such neurodegenerative conditions, where the usual concerns of ethics, infectious disease transmissibility, and immunological reactions, etc., can be dismissed.

Acknowledgements

The authors gratefully acknowledge the encouragement and support of Reliance Life Sciences Pvt Ltd in carrying out the research work (http://www.relbio.com).

References

Carl AG, Emigdio, R, Mandolin, JW, Jeferry, LS. Enhanced engraftment of mesenchymal stem cells in a cutaneous wound model by culture in allogenic species-specific serum and administration in fibrin constructs. Stem Cell 2006:24:10:2232-43
Crossref   1st Citation  

Chen Y, Teng, FYH, Tang, BL. Coaxing bone marrow stromal stem cells towards neuronal differentiation: progress and uncertainties. Cell Mol Life Sci 2006:63:14:1649-57
Crossref   Medline   1st Citation  

Cho KJ, Trzaska, KA, Greco, SJ, McArdel, J, Wang, FS, Ye, JW. Neurons derived from human mesenchymal stem cells show synaptic transmission and can be induced to produce the neurotransmitter substance P by interleukin-1 alpha. Stem Cell 2005:23:3:383-91
Crossref   1st Citation  

Choi CB, Cho, YK, Prakash, KV, Jee, BK, Han, CW, Paik, YK. Analysis of neuron-like differentiation of human bone marrow mesenchymal stem cells. Biochem Biophys Res Commun 2006:350:1:138-46
Crossref   Medline   1st Citation  

Deng J, Petersen, BE, Steindler, DA, Jorqensen, ML, Laywell, DL. Mesenchymal stem cells spontaneously express neural proteins in culture and are neurogenic after transplantation. Stem Cell 2006:24:4:1054-64
Crossref   1st Citation  

Edwin MH, Patricia, LG, Winston, KK, Jeffrey, CM, Michael, DN, Rene, YM. Isolated allogeneic bone marrow-derived mesenchymal cells engraft and stimulate growth in children with osteogenesis imperfecta: implications for cell therapy of bone. Proc Natl Acad Sci U S A 2002:99:13:8932-7
Crossref   Medline   1st Citation  

El-Badri Nagwa S, Amal, H, Samuel, S, Xiaomei, L, Sriram, M, Alison, EW. Cord blood mesenchymal stem cells: potential use in neurological disorders. Stem Cell Dev 2006:15:4:497-506
Crossref   1st Citation  

Freed CR, Greene, PE, Breeze, RE, Tsai, WY, DuMouchel, W, Kao, R. Transplantation of embryonic dopamine neurons for severe Parkinson's disease. N Engl J Med 2001:344:710-9
Crossref   Medline   1st Citation  

Hellmann MA, Panet, H, Barhum, Y, Melamed, E, Offen, D. Increased survival and migration of engrafted mesenchymal bone marrow stem cells in 6-hydroxydopamine-lesioned rodents. Neurosci Lett 2006:395:2:124-8
Crossref   Medline   1st Citation  

Inna K, Tali, BZ, Yael, B, Yossef, SL, Alex, B, Tirza, C. Dopaminergic differentiation of human mesenchymal stem cells-Utilization of bioassay for tyrosine hydroxylase expression. Neurosci Lett 2007:419:28-33
Crossref   Medline   1st Citation   2nd  

Karen B, Susanne, K, Herald, K, Eichler, H. Critical parameters for the isolation mesenchymal stem cells from umbilical cord blood. Stem Cell 2004:22:625-34
Crossref   1st Citation   2nd  

Krampera M, Marconi, S, Pasini, A, Galie, M, Rigotti, G, Mosna, F. Induction of neural-like differentiation in human mesenchymal stem cells derived from bone marrow, fat, spleen and thymus. Bone 2007:40:2:382-90
Crossref   Medline   1st Citation   2nd  

Le Blanc K, Ringden, O. Mesenchymal stem cells: properties and role in clinical bone marrow transplantation. Curr Opin Immunol 2006:18:5:586-91
Crossref   Medline   1st Citation  

Long X, Olzewksi, M, Huang, W, Kletzel, M. Neural cell differentiation in vitro from adult human bone marrow mesenchymal stem cells. Stem Cell Dev 2005:14:65-9
Crossref   1st Citation  

Mark FP, Alastair, MM, Stephen, CB, Rama, KJ, Robin, D, Mosca, JC. Multilineage potential of adult human mesenchymal stem cells. Science 1999:284:5411:143-7
Crossref   Medline   1st Citation  

Meuleman N, Tondreau, T, Delforge, A, Dejeneffe, M, Massy, M, Libertalis, M. Human marrow stem cell culture: serum free medium allows better expansion than classical a-MEM medium. Eur J Haematol 2006:76:309-16
Crossref   Medline   1st Citation  

Mizuno N, Shiba, H, Ozeki, Y, Mouri, Y, Niitani, M, Inui, T. Human autologous serum obtained using a completely closed bag system as a substitute for fetal calf serum in human mesenchymal stem cell cultures. Cell Biol Int 2006:30:521-4
Crossref   Medline   1st Citation  

Ran B, Yossef, SL, Eldad, M, Daniel, O. Adult stem cells for neuronal repair. Stem Cell Res 2006:8:61-6
1st Citation  

Ravindran G, Rao, H. Enriched NCAM-Positive cells form functional dopaminergic neurons in rat model of Parkinson's disease. Stem Cell Dev 2006:15:4:572-82
1st Citation  

Sanchez-Ramos JR. Neural cells derived from adult bone marrow and umbilical cord blood. J Neurosci Res 2002:69:6:880-93
Crossref   Medline   1st Citation  

Shetty P, Bharucha, K, Tanavde, V. Human umbilical cord blood serum can replace fetal bovine serum in the culture of mesenchymal stem cells. Cell Biol Int 2007:31:293-8
Crossref   Medline   1st Citation   2nd  

Stefano P, Lucia, Z, Michela, D, Gianvito, M. Neural stem cells and their use as therapeutic tool in neurological disorders. Brain Res Rev 2005:48:211-9
Crossref   Medline   1st Citation  

Tanavde V, Malehorn, M, Lumkul, R, Gao, Z, Wingard, J, Garette, ES. Human stem progenitor cells from neonatal cord blood have greater haematopoietic expansion capacity than those from mobilized adult blood. Exp Hematol 2002:30:816-23
Crossref   Medline   1st Citation  

Tondreau T, Lagneaux, L, Dejeneffe, M, Massy, M, Mortier, C, Delforge, A. Bone marrow-derived mesenchymal stem cells already express specific neural proteins before any differentiation. Differentiation 2004:72:7:319-26
Crossref   Medline   1st Citation  

Woodbury D, Schwarz, EJ, Prockop, DJ, Black, IB. Adult rat and human bone marrow stromal cells differentiate into neurons. J Neurosci Res 2000:61:4:364-70
Crossref   Medline   1st Citation  


Received 14 August 2008/13 January 2009; accepted 7 May 2009

doi:10.1016/j.cellbi.2009.05.002


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)