Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2010) 34, 579–586 (Printed in Great Britain)
Immortalization of bovine mammary epithelial cells alone by human telomerase reverse transcriptase
Chen‑Fu Zhao, Hong‑Yu Hu, Lu Meng, Qian‑Qian Li and AI‑Xing Lin1
National Key Laboratory for Agrobiotechnology, College of biological sciences, China Agricultural University, Yuanmingyuan Xi lu, Haidian District, Beijing 100193, Peoples Republic of China


Immortal bovine mammary epithelial cell lines are useful for providing an efficient indicator for transgene expression and for the technological improvement of genetic modification. The preparation of hTERT (human telomerase reverse transcriptase)-mediated immortalized MECs (mammary epithelial cells) requires a down-regulation of p16INK4a. Here, we report the establishment of two immortal bovine MEC lines by expression of hTERT gene alone under serum-containing culture conditions. This two cell lines maintain the general characteristics of MECs and have been stably passed more than 200 generations accompanying telomere extension, and were identified as non-malignant transformation. Investigation on transcriptional profile showed a similar down-regulation in both p16INK4a and p53. By comparing with non-immortal hTERT-positive MECs, we speculated that there are some spontaneous p16INK4a-reduced cells under normal culture conditions and the immortalization required for a co-ordinate repression of p53 and p16INK4a signalling pathways. Interestingly, two immortal cell lines showed a significant distinction in proliferation rate, implying that other mechanisms might be involved in proliferation control.


Key words: human telomerase reverse transcriptase (hTERT), immortalization, p16INK4a, p53

Abbreviations: BLG, β-lactoglobulin, BMEC, bovine mammary epithelial cell, FCM, flow cytometry, hTERT, human telomerase reverse transcriptase, MEC, mammary epithelial cell, PD, population doublings, SA-β-gal, senescence-associated β-galactosidase

1To whom correspondence should be addressed (email linaix@cau.edu.cn).


1. Introduction

The production of valuable pharmaceutical proteins in animal milk is called an animal bioreactor (Lubo and Palmer, 2000), and is a process that needs a transgene to be adequately expressed. Thus, in vitro BMECs (bovine mammary epithelial cells) are a useful model for investigation of mammary-gland-specific expression or for gene targeting of somatic cell. However, the limited cell life span is a barrier for these researches. It is desirable to establish immortal BMECs. Several immortal MECs have been established by transfection of the SV40 (simian virus 40) Large T gene or TERT (telomerase reverse transcriptase) gene (Kim et al., 2002; Toouli et al., 2002). However, gene expression changes on the immortalization of MECs have been less investigated.

In in vitro culture, normal somatic cells have a limited proliferation capacity and inevitably enter a state of replicative senescence (Hayflick and Moorehead, 1961). Telomere shortening is associated with each cell division (Reaper et al., 2004). When the telomere is reduced to a certain extent, it initiates a DNA damage response signal and activates the p53-dependent cell signalling pathway, leading to irreversible growth arrest (Vaziri and Benchimo, 1998; Reaper et al., 2004). Telomeres are synthesized by telomerase, a specialized reverse transcriptase, which comprises two principal subunits: TERT (telomerase reverse transcriptase), the protein catalytic subunit and the telomerase RNA component (TERC) (Nakamura and Cech, 1998). TERT gene is expressed in undifferentiated stem cells and is inactivated in somatic cells, but re-activated in many cancer cells (Harley et al., 1990; Kim et al., 1994). It has been demonstrated that overexpression of hTERT increases cell proliferative capacity by suppressing the activity of p53 and improving cellular tolerance to p53-dependent signalling pathways (Beliveau and Yaswen, 2007; Beliveau et al., 2007). Moreover, hTERT expression can also avoid the telomere shortening of normal diploid cells and cause an exponential phase extension and cell immortalization (Chang et al., 2005; Richardson et al., 2007). Hence, expression of TERT has been used in a number of cell immortalizations (Effros, 2007; Serakinci et al., 2007). However, TERT expression alone is considered to be insufficient to immortalize MECs unless the p16INK4a expression is reduced directly or indirectly, for example, by using RNAi (RNA interference) or culturing in a serum-free culture system (Kim et al., 2002; Yaswen and Stampfer, 2002; Haga et al., 2007). It is unclear whether MECs under normal culture conditions could be directly immortalized by expression of exogenous TERT gene.

2. Materials and methods

2.1. Cell culture, gene transfection and cell selection

Bovine breast tissue samples were obtained from a Chinese Holstein cow aged 2 years. The tissue was co-digested with trypsin (Sigma), collagenase (Sigma) and hyaluronidase (Sigma) and the primary BMECs were cultured in incubator with 5% CO2 at 37°C. Passage cells (two times) which grew to 70% density in 60-mm culture dishes were transfected using linearized hTERT gene via FuGENE® HD transfection reagent (Rose Co) according to appropriate local Institutional Review Board approved protocols/ethical approval procedures. After 2 weeks selection with puromycin (2.5 μg/ml), each cell clone was seeded in culture plates of 96 wells to expand the culture, and they were partly cryopreserved. All types of cells were cultured in DMEM (Dulbecco’s modified Eagle’s medium)–F12 containing 10% fetal bovine serum (FBS), 5 μg/ml insulin, 10 ng/ml epidermal growth factor, 0.5 μg/ml hydrocortisone, 100 units/ml penicillin and 100 μg/ml streptomycin, except the MCF-7 cell line which was cultured in DMEM with 10% FBS. The plasmid pLPC–hTERT was kindly donated by Geron Co.

2.2. MTT method

Exponential phase cells were collected at regular intervals and seeded in 96-well plates at a density of 5000 cells/well, five wells for each sample, then cultured in an incubator at 37°C, 5% CO2 for 48 h. The medium was replaced and 20 μl of MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide] solution (5 mg /ml) was added. The plates were further incubated for 4 h, then the supernatant was carefully removed and 150 μl of DMSO was added to each well. Oscillation was performed for 10 min, and absorbance values at 490 nm were measured in an automated ELISA instrument. Mean values of relative absorbance of groups were recorded to draw the proliferative curve. Each assay was performed in triplicate.

2.3. FCM (flow cytometry) analysis of the cell cycle

Digested cells were washed twice with PBS and fixed in precooled 80% ethanol overnight at 4°C. Fixative was removed by centrifugation and washed once again with PBS and resuspended with 5 μl of RNaseA solution (10 mg/ml) and incubated for 30 min at 37°C. Thereafter, a staining solution of PI (propidium iodide) was added to a final concentration of 25 μg/ml. After 4°C staining in the dark for 30 min, fluorescence detection was performed by FACSort flow cytometry, and the cell-cycle-phase characteristics were analysed with ModFit LT software. The data were averages for three repetitions.

2.4. SA-β-gal (senescence-associated β-galactosidase) assay

BMECs at 10 PD (population doublings) and 34 PD, BME-hT45-Cs at 330 PD, BME-hT55-Cs at 220 PD and BME-hT33-Cs at 33 PD were washed twice with PBS. Cells were fixed with 4% formaldehyde for 10 min and then were washed twice with PBS. Subsequently, staining was performed with X-gal solution (1 mg/ml X-gal, 0.12 mM K4Fe[CN]6, 0.12 mM K3Fe[CN]6, 1 mM MgCl2 in PBS at pH 6.0) for 12 h at 37°C and washed with PBS, then observed under the microscope and photographed.

2.5. Soft agar assay

Soft agar assays were performed in duplicate with a cell density of 300 cells/cm2 as previously described (Diglio et al., 1983). MCF-7 cells were used as a positive control. The ability for anchorage-independent growth shown by colony formation was analysed after 3 weeks. Clones containing more than ten viable cells were scored positive.

2.6. Determination of telomere length

The mean telomere length was evaluated and quantified by the method of TRF (telomere restriction fragment) analysis (Takeki et al., 2003). The DNA (2 μg) of each type of cells was digested with a HinfI/RsaI mixture (10 units each) and subjected to 0.6% agarose gel electrophoresis. To ascertain that a comparable amount of DNA from individual cells was loaded in each lane, the gel was stained with ethidium bromide and examined by UV light. A specific biotinylated detection telomere probe (TTAGGG)4 was used in hybridization. Luminescence Detection Kit (Roche) was used for telomere DNA imaging. DNA marker was used to determine the telomere length of various samples.

2.7. RT-PCR detection of gene expression

Cell total RNAs were extracted with an RNA extraction kit (Tiangen Co.), and 5 μg of total RNA of each sample was taken for reverse transcription. A 1 μl reverse-transcription product was taken as a template for PCR amplification, with β-actin as the internal reference. Gene names, primer sequences and amplified fragment lengths are shown in Table 1. Amplification conditions: 95°C, 30 s; 55°C, 30 s; 72°C, 25 s; 30 cycles in a 25 μl reaction system. PCR products were detected by electrophoresis on a 1.2% agarose gel. A standard DNA marker used as a control and the amount of gene expression was estimated with grey-scale analysis.


Table 1 Primer pairs used in the real-time PCR experiments of gene expression profiles

Gene GenBank® accession number Sense primer (5′→3′) Antisense primer (5′→3′) Product size (bp)
TRPS-1* NM014112* GCCTTCTTTGAGTTCGGA CCCTCTGCTGTTTGTTGAG 384
bag-1 NM001076291 TGCCATTGTCAGCACTTG TGTTCTGTTCCACTGTGTCAC 376
bTERT NM001046242 TCACGGGTCAAGACGCTGT CGGGCATAACTGGAGTGGT 886
hTERT AF128893 ACCGAGTGACCGTGGTTT TCTGATTCCAATGCTTTGC 978
p16INK4a XM868375 TGATTACAGTGAGGATTCGG AACCAGTGTGTTTGGAGTCA 351
p53 NM174201 CGGAACACCTTTAGACACAGT CCTACCAACACCAGCTCCTCT 321
BLG NM173929 TCATTGTCACCCAGACCA GCTCAGCACTGTTCTCCAT 325
β-Casein NM181008 GGAACAGCAGCAAACAGAG CGGACTGAGGAGGAAACAT 376
β-Actin NM173979 ACACGGTGCCCATCTATGA AGGAAGGAAGGCTGGAAGAG 318


*As the cDNA sequence of bovine TRPS-1 had not been reported, these primer pairs were designed by comparing the sequence of the Homo sapiens genome with the Bos taurus genome. All other primer sequences were from GenBank®. Each pair of primers span intron–extron boundaries.


3. Results

3.1. BMECs immortalized by TERT alone in company with distinct growth advantage

After transfection of hTERT gene, cells were selected after 2 weeks using puromycin, and 47 colonies were obtained. Thirty-three colonies of them maintained the typical cobblestone morphology and were used to expand cultivation and continuous passage. Although all cell colonies were hTERT-positive, the majority of colonies stopped growing at 35 PD and displayed senescence features with a large and flat morphology (Figures 1A and 1B). One of the non-immortalized TERT-positive colonies was named BME-hT33-Cs (Figures 1C and 1D) and was used as the control in subsequent experiments. There were two colonies, however, BME-hT45-Cs (Figure 1E) and BME-hT55-Cs (Figure 1F) that maintained a pebble-like morphology and continued division. At present, these two cell lines have been passed more than 220 PD and 370 PD respectively.

The cell growth record showed that the two immortalized cell lines had an obvious difference in growth rate. As shown in Figure 2(A), non-immortalized BME-hT33-Cs had a similar growth rate to that of normal BMECs. The growth of immortalized BME-hT55-Cs was slightly faster than BMECs and was always maintained in an exponential state. Interestingly, immortalized BME-hT45-Cs grew very rapidly with an average of 12 h for a generation. These results were coincident with the analysis of FCM data, in which BME-hT45-Cs had a higher S phase fraction than BME-hT55-Cs, but both were significantly higher than control BMECs (10 PD); in parallel, the BME-hT33-Cs (34 PD) were blocked at G1 phase (Figure 2B). Further SA-β-gal showed negative staining in BMECs (10 PD), BME-hT45-Cs (330 PD) and BME-hT55-Cs (220 PD), while strong positive staining in non-immortalized hTERT-positive cells (BME-hT33-Cs 33PD) and BMECs (34 PD) (Figure 2C). Together, these results suggested that immortalized cell lines had a proliferative advantage and showed a distinct proliferation capability.

In addition, in order to assess the cell function in expression of milk proteins, we detected the induced expression of β-casein and BLG (β-lactoglobulin) gene at the mRNA level. The result showed that the β-casein gene was expressed in all mammary cell lines (Figure 2D). Interestingly, the BLG gene was undetectable in rapid-growth cells (BME-hT45-Cs 220 PD).

3.2. Immortalized cell lines exhibited non-malignant transformation state

Both immortalized cell lines could not grow under serum starvation conditions, and the growth depended on the addition of insulin, hydrocortisone and epidermal growth factor, after which normal BMECs growth characteristics were seen. Moreover, there was an obvious phenomenon in cell contact inhibition (data unshown).

To determine whether immortalized cells have cancer cell potential, soft agar growth experiments were performed. Result showed that BME-hT45-Cs, BME-hT55-Cs, BME-hT33-Cs and normal BMECs were unable to grow in soft agar, whereas the control MCF-7 breast cancer cells grew well (Figure 3A), suggesting that the two immortalized cell lines had the normal growth characteristics of anchor dependency and no tendency to malignant transformation (Diglio et al., 1983). This notion was enhanced by the detection of breast cancer-specific markers genes (TRPS-1 and Bag-1) (Tang, 2002; Radvanyi et al., 2005). The expressions in both immortalized cells were similar to normal cells but significantly differed from MCF-7 cells (Figure 3B).

3.3. Telomere extension by expression of hTERT is insufficient to immortalize BMECs

TERT gene is regarded as function marker of telomerase (Nakamura and Cech, 1998). RT-PCR results showed significant expression in three hTERT-transfected cell lines (immortalized and non-immortalized), but undetectable expression in BMECs. The endogenous bTERT was absent in all cell lines (Figure 4A). Measurement of telomere length by Southern hybridization showed that it was significantly longer in the three TERT-transfected cell lines, namely 18.4, 18.1 and 18.9 kb for immortalized BME-hT45-Cs BME-hT55-Cs and non-immortalized BME-hT33-Cs respectively, compared with only 6.4 kb in 22 PD of control BMECs (Figure 4B). These results indicated that the expression of exogenous hTERT promoted telomere extension, but that was not sufficient to ensure that MECs become immortalized.

3.4. The expression of p16INK4a and p53 was down-regulated in immortalized cells

The cell-cycle genes p16INK4a and p53 are considered as carcinoma inhibition genes and play a crucial role in the regulation of cell proliferation and cell senescence (Foster and Galloway, 1996; Sheahan et al., 2008). As the results have shown, p16INK4a was highly expressed in the BME-hT33-Cs and 30 PD of BMECs, while significantly down-regulated (one-fifth of BMECs) in the two immortalized cell lines. p53 was highly expressed in the BMECs, but reduced (one-fourth of BMECs) in all three hTERT-positive cell lines; in parallel, P21 (a downstream gene of p53) was down-regulated (Figure 5). It is noteworthy that although similar low expression of p53 and p21 were present in all three hTERT-positive cell lines, p16INK4a was significantly highly expressed only in non-immortalized cell lines (hTERT-positive) (lane 2), implying that the down-regulation of p16INK4a was indispensable in the immortalization of BMECs.

4. Discussion

Although p16INK4a can be reduced in serum-free culture conditions and MECs are then able to be immortalized by expression of hTERT (Brenner et al., 1998; Kim et al., 2002; Haga et al., 2007), the operation this process is relatively more cumbersome, whereby primary cells pass about 10 passages, and only some possibly p16INK4a-reduced cell colonies are alive. In this study, we succeeded in immortalizing of MECs by direct transfection with the TERT gene. This result indicated that p16INK4a is spontaneously down-regulated in a small number of cells under serum-containing culture conditions and is capable of immortalizing cells by co-ordinating with the hTERT gene. As 34 non-immortalized hTERT-positive cells were obtained correspondingly, we speculated that about 17% of cells show a down-regulation of p16INK4a. Noticeably, it has been reported that a certain proportion of breast stem cells is present in normal cells (Smith and Chepko, 2001), and the incidence of breast cancer is high when p16INK4a is silent or down-regulation has been reported (Elayat et al., 2009). According to the CSC (cancer stem cell) hypothesis, cancer is initiated and driven by aberrant stem cells derived from normal, tissue-specific stem cells and/or stem cell niches (Kai et al., 2009). Thus, some cells with spontaneous down-regulation of p16INK4a probably represent the breast stem cells (or potential tumour initial cells), which remains to be further researched. It is unclear whether the same down-regulation is present in other cell strains.

The inactivation or down-regulation of p53 and the extension of the telomere are the characteristics of many immortalized cells or cancer cells (Hochedlinger et al., 2005; Beliveau and Yaswen, 2007). Thus, hTERT expression and subsequent p53 inhibition seem to be able to immortalize BMECs as reported on other cells (Effros, 2007; Serakinci et al., 2007). However, many hTERT-positive cell colonies in this study could not escape from irreversible cellular senescence, although the telomere length is extended and p53 is inhibited. This result suggests that the telomere extension and the suppression of the p53 signalling pathway are not sufficient to immortalize BMECs, but on the other hand, enhances our understanding of the important role of p16INK4a in controlling lifespan. Moreover, analysis of gene expression in different hTERT-positive cells showed that there is no correlation between p16INK4a and p53, indicating that the function of p16INK4a is independent of the p53 signal pathway, and both suppressions are required for immortalization of MECs. In cancer cells, it is shown that p16INK4a and p53 are two independent signalling pathways (Sherr, 2001). However, it is reported that p16INK4a gene activity inversely modulates the p53 protein level in human primary MECs but not in fibroblasts (Zhang et al., 2006). Thus, it seems that the interaction between p16INK4a and p53 signalling pathways conditionally occurs and is lost in immortal BMECs. In addition, while the expression of p53 and p16INK4a and the telomere length in two immortalized BMECs are basically the same, the proliferation rate are significantly different, indicating there is not necessarily a link between cell proliferation capability and immortalization. We speculate that other independent pathways could be involved in immortal BMECs proliferation capability.

In conclusion, with a simple and efficient method, we have established two immortal bovine mammary epithelial cell lines, which are useful tools in research of signal pathways, as well as evaluation of transgene expression. We confirmed that the immortalization of BMECs requires a synergistic action between p16INK4a and p53 pathways, and other control mechanisms might be involved in the proliferation capability of immortalized BMECs. This study offers an insight into the mechanism of BMEC immortalization and senescence.

Author contribution

Chen-Fu Zhao carried out gene transfection, cell selection, cell culture, cell proliferative analysis, cell cycle analysis, RT-PCR analysis, participated in the conceiving and design of the study and drafted the manuscript. Hong-Yu Hu carried out the telomere length analysis and assisted in cell culture. Lu Meng performed the senescence-associated β-galactosidase assay and soft agar assay with Qian-Qian Li. AI-Xing Lin performed the co-ordination of the study, participated in the conceiving and design of the study and helped draft the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We acknowledge the support of the Stem Cell Research Center of Peking University Health Science Center in providing the MCF-7 cell line.

Funding

This work was supported by the National Natural Science Foundation of China [grant numbers 30570947 and 30370726]; and partly supported by the National High-Tech Research and Development Programme of China [863 Program, grant number 2006AA02Z113].

REFERENCES

Beliveau, A, Bassett, E, Lo, AT, Garbe, J, Rubio, MA and Bissell, MJ (2007) P53-dependent integration of telomere and growth factor deprivation signals. Proc Natl Acad Sci USA 104, 4431-6
Crossref   Medline   1st Citation  

Beliveau, A and Yaswen, P (2007) Soothing the watchman: telomerase reduces the p53-dependent cellular stress response. Cell Cycle 6, 1284-7
Medline   1st Citation   2nd  

Brenner, AJ, Stampfer, MR and Aldaz, CM (1998) Increased p16 expression with first senescence arrest in human mammary epithelial cells and extended growth capacity with p16 inactivation. Oncogene 17, 199-205
Crossref   Medline   1st Citation  

Chang, MW, Grillari, J, Mayrhofer, C, Fortschegger, K, Allmaier, G and Marzban, G (2005) Comparison of early passage, senescent and hTERT immortalized endothelial cells Experimental. Cell Res 309, 121-36
Crossref   1st Citation  

Diglio, CA, Wolfe, DE and Meyers, P (1983) Transformation of rat cerebral endothelial cells by Rous sarcoma virus. J Cell Biol 97, 15-21
Crossref   Medline   1st Citation   2nd  

Effros, RB (2007) Telomerase induction in T cells: a cure for aging and disease? J Exp Gerontol 42, 416-20
Crossref   1st Citation   2nd  

Elayat, G, Selim, AG and Wells, CA (2009) Alterations of the cell cycle regulators cyclin D1, cyclin A, p27, p21, p16, and pRb in apocrine metaplasia of the breast. Breast J 15, 475-82
Crossref   Medline   1st Citation  

Foster, SA and Galloway, DA (1996) Human papillomavirus type 16 E7 alleviates a proliferation block in early passage human mammary epithelial cells. Oncogene 12, 1773-9
Medline   1st Citation  

Haga, K, Ohno, S, Yugawa, T, Narisawa-Saito, M, Fujita, M and Sakamoto, M (2007) Efficient immortalization of primary human cells by p16INK4a-specific short hairpin RNA or Bmi-1, combined with introduction of hTERT. Cancer Sci 98, 147-54
Crossref   Medline   1st Citation   2nd  

Harley, CB, Futcher, AB and Greider, CW (1990) Telomeres shorten during ageing of human fibroblasts. Nature 345, 458-60
Crossref   Medline   1st Citation  

Hayflick, L and Moorehead, PS (1961) The serial cultivation of human diploid cell strains. Exp Cell Res 25, 585-621
Crossref   1st Citation  

Hochedlinger, K, Yamada, Y, Beard, C and Jaenisch, R (2005) Ectopic expression of Oct-4 blocks progenitor-cell differentiation and causes dysplasia in epithelial tissues. Cell 121, 465-77
Crossref   Medline   1st Citation  

Kai, K, Arima, Y, Kamiya, T and Saya, H (2009) Breast cancer stem cells. Breast Cancer doi: 10.1007/s12282-009-0176-y
Crossref   1st Citation  

Kim, H, Farris, J, Christman, SA, Kong, BW, Foster, LK and O’Grady, SM (2002) Events in the immortalizing process of primary human mammary epithelial cells by the catalytic subunit of human telomerase. J Biochem (Tokyo) 365, 765-72
1st Citation   2nd   3rd  

Kim, NW, Piatyszek, MA, Prowse, KR, Harley, CB, West, MD and Ho, PL (1994) Specific association of human telomerase activity with immortal cells and cancer. Science 266, 2011-5
Crossref   Medline   1st Citation  

Lubo, H and Palmer, C (2000) Transgenic animal bioreactors—where we are. Transgenic Res 9, 301-4
Crossref   Medline   1st Citation  

Nakamura, TM and Cech, TR (1998) Reversing time: origin of telomerase. Cell 92, 587-90
Medline   1st Citation   2nd  

Radvanyi, L, Singh-Sandhu, D, Gallichan, S, Lovitt, C, Pedyczak, A and Mallo, G (2005) The gene associated with trichorhinophalangeal syndrome in humans is overexpressed in breast cancer. Proc Natl Acad Sci USA 102, 11005-10
Crossref   Medline   1st Citation  

Reaper, PM, Fagagna, F and Jackson, SP (2004) Activation of the DNA damage response by telomere attrition: a passage to cellular senescence. Cell Cycle 3, 543-6
Medline   1st Citation   2nd  

Richardson, RM, Nguyen, B, Holt, SE, Broaddus, WC and Fillmore, HL (2007) Ectopic telomerase expression inhibits neuronal differentiation of NT2 neural progenitor cells. J Neurosci Lett 421, 168-72
Crossref   1st Citation  

Serakinci, N, Christensen, R, Graakjaer, J, Cairney, CJ, Keith, WN and Alsner, J (2007) Ectopically hTERT expressing adult human mesenchymal stem cells are less radiosensitive than their telomerase negative counterpart. J Exp Cell Res 313, 1056-67
Crossref   1st Citation   2nd  

Sheahan, S, Bellamy, CO, Harland, SN, Harrison, DJ and Prost, S (2008) TGFbeta induces apoptosis and EMT in primary mouse hepatocytes independently of p53, p21Cip1 or Rb status. BMC Cancer 8, 191-202
Crossref   Medline   1st Citation  

Sherr, CJ (2001) The INK4a/ARF network in tumour suppression. Nat Rev 2, 731-7
Crossref   1st Citation  

Smith, GH and Chepko, G (2001) Mammary epithelial stem cells. Microsc Res Techn 52, 190-203
Crossref   1st Citation  

Takeki, T, Shin-ichi, K, Yukiko, T, Takeo, WT, Mizuki, S and Tokihiro, H (2003) Immortal, telomerase-negative cell lines derived from a Li–Fraumeni syndrome patient exhibit telomere length variability and chromosomal and minisatellite instabilities. Carcinogenesis 24, 953-65
Crossref   Medline   1st Citation  

Tang, SC (2002) BAG-1, an anti-apoptotic tumour marker. IUBMB Life 53, 99-105
Crossref   Medline   1st Citation  

Toouli, CD, Huschtscha, LI, Neumann, AA, Noble, JR, Colgin, LM and Hukku, B (2002) Comparison of human mammary epithelial cells immortalized by simian virus 40 T-Antigen or by the telomerase catalytic subunit. Oncogene 21, 128-39
Crossref   Medline   1st Citation  

Vaziri, H and Benchimo, S (1998) Reconstitution of telomerase activity in normal human cells leads to elongation of telomeres and extended replicative life span. Curr Biol 8, 279-82
Crossref   Medline   1st Citation  

Yaswen, P and Stampfer, MR (2002) Molecular changes accompanying senescence and immortalization of cultured human mammary epithelial cells. Int J Biochem Cell Biol 34, 1382-94
Crossref   Medline   1st Citation  

Zhang, J, Pickering, CR, Holst, CR, Gauthier, ML and Tlsty, TD (2006) P16INK4a Modulates p53 in primary human mammary epithelial cells. Cancer Res 66, 10325-31
Crossref   Medline   1st Citation  


Received 11 January 2010/2 February 2010; accepted 23 February 2010

Published as Cell Biology International Immediate Publication 23 February 2010, doi:10.1042/CBI20100006


© 2010 The Author(s) Journal compilation © 2010 Portland Press Ltd


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)