| Cancer | ![]() |
Cell death | ![]() |
Cell cycle | ![]() |
Cytoskeleton | ![]() |
Exo/endocytosis | ![]() |
Differentiation | ![]() |
Division | ![]() |
Organelles | ![]() |
Signalling | ![]() |
Stem cells | ![]() |
Trafficking |
|
|
Cell Biology International (2010) 34, 883891 (Printed in Great Britain)
ChIP (chromatin immunoprecipitation) analysis demonstrates co-ordinated binding of two transcription factors to the promoter of the p53 tumour-suppressor gene
Amanda Polson, Paula Takahashi and David Reisman1
Department of Biological Sciences, University of South Carolina, Columbia, SC 29208, U.S.A.
p53 is a tumour-suppressor protein that plays a role in many cellular processes, including regulation of the cell cycle, DNA repair, transcriptional regulation of genes, chromosomal segregation, cell senescence and apoptosis. The protein's role as a transcription factor has shown that deregulated transcription, whether increased or decreased, has the potential to contribute to the formation of human cancers. It was previously reported that binding of two transcription factors, C/EBPβ and RBP-Jκ, to a regulatory site on the p53 promoter regulates its activity, in vitro, in a cell cycle-dependent manner. C/EBPβ is a CCAAT enhancer-binding protein that is a member of the basic leucine zipper transcription factor (bZIP) family that plays an important role in mediating cell proliferation, differentiation and can also be involved in inflammatory responses, metabolism, cellular transformation, oncogene-induced senescence and tumorigenesis. RBP-Jκ participates in the transcriptional regulation of target genes by interacting with the cytoplasmic domain of the Notch receptors. When RBP-Jκ is released, transcriptional repression of its target genes occurs through the recruitment of co-repressor complexes and prevents transcription from occurring. Our reports, here and previously published, show that repression of p53 by RBP-Jκ and activation of p53 by C/EBPβ through differential binding of these two factors indicates a type of co-operative regulation in p53 expression. Here, we demonstrate through the use of chromatin immunoprecipitation (ChIP) assays that the co-ordinated binding of these two factors to the p53 promoter occurs in vivo and serves to regulate p53's activity during the cell cycle. Key words: C/EBPβ, cancer, cell cycle, p53, RBP-Jκ, transcription Abbreviations: bZIP, basic leucine zipper transcription factor, C/EBPβ-2, CCAAT enhancer-binding protein β-2, DB, dialysis buffer, DMEM, Dulbecco's modified Eagle's medium, EMSA, electrophoretic mobility shift assay, Exp, exponentially, FBS, fetal bovine serum, GAPDH, glyceraldehyde-3-phosphate dehydrogenase, IL-6, interleukin-6 1To whom correspondence should be addressed (email reisman@biol.sc.edu). 1. Introduction p53 is an important tumour-suppressor protein that is associated with many cellular processes including, but not limited to, regulation of the cell cycle, DNA repair, transcriptional regulation of genes, chromosomal segregation, cell senescence and apoptosis (Chen et al., 1996; Vogelstein et al., 2000; Zhao, et al., 2009). p53 protein has the ability to maintain stability of the genome through the induction of several intracellular and extracellular factors (Vousden and Lu, 2002; Zhao, et al., 2009). When damage to DNA occurs, p53 expression goes up, due to increased stability of the p53 protein. The accumulation of p53 triggers a cascade of events that can lead to either cell cycle arrest or apoptosis of the cell. In order to establish genomic stability, p53 acts as a sequence-specific transcription factor; its role as a transcription factor is important because it functions as a regulator for the expression of genes located downstream in the checkpoint pathway (Vousden and Lu, 2002; Zhao, et al., 2009). Many of these downstream genes are required for cell cycle arrest and/or apoptosis (Vousden and Lu, 2002; Zhao, et al., 2009). The regulation of these genes leads to the prevention of damaged DNA from being replicated. One important role of the p53 protein is to activate and monitor checkpoints in the cell cycle. These checkpoints are located at the end of G1, prior to S-phase, and just after S-phase at the beginning of the G2-phase (Vogelstein et al., 2000; Toyoshima, 2009). These p53 cell cycle checkpoints become activated in response to DNA damage in the forms of UV light or other DNA-damaging agents (Vogelstein et al., 2000), lack of oxygen (An et al., 1998) and/or in the expression of oncogenes such as myc or ras (Bates et al., 1998). As p53 becomes activated and its levels within the cell increase, entry into S-phase is inhibited (Vogelstein et al., 2000; Sharpless and DePinho, 2002; Vousden and Lu, 2002). Regulation of p53 is important because its inactivation results in the loss of the apoptotic response and/or failure to arrest the cell cycle in response to cellular stress or DNA damage. This inactivation could possibly lead to the development of cancers, increased numbers of mutations and/or genetic instability. These important findings related to p53 expression are critical to the formation of cancer because they suggest that loss of the protein is a crucial event in the induction of tumorigenesis. Being a critical regulator of cell growth, it is essential that p53's expression be tightly controlled. It has been reported that, in many cancers, p53 transcription is deregulated (Khoo et al., 2009). The protein's role as a transcription factor has shown that deregulated transcription, whether it is increased (as is the case with mutant p53 transcription) or decreased (failure to activate transcription of wild-type p53), has the potential to contribute to the formation of human cancers (Vousden and Lu, 2002). Most of the information known about p53 is at the protein level, and the molecular basis for transcriptional regulation of the p53 gene has been minimally defined. Understanding the transcriptional regulation of the p53 gene will ultimately contribute to our understanding of mechanisms regulating the overall levels of p53 protein. By focusing on the transcriptional regulation of p53, we hope to elucidate key factors that control p53's expression. p53's expression is tightly monitored, which serves as a mechanism to ensure genomic stability prior to cells entering S-phase and also possibly to make certain that the protein is rapidly induced in response to DNA damage. In addition to alterations in protein stability, it is generally accepted that regulation of the p53 protein levels is also correlated to how the gene is transcriptionally regulated (Takaoka et al., 2003). It has been previously reported that the transcription factor C/EBPβ-2 (CCAAT enhancer-binding protein β-2) binds to an important regulatory site that is approx. 960 bp upstream of the transcription start site on the murine p53 promoter in response to mitogen stimulation in a cell cycle-dependent manner (Boggs and Reisman, 2007). This binding of C/EBPβ-2 to the p53 regulatory site positively regulates transcription of the p53 gene in a manner that is similar to the pattern of p53 expression noted as cells are induced to enter S-phase (Boggs and Reisman, 2006; Boggs and Reisman, 2007). This pattern is lost in cells that are defective in proper p53 regulation (Boggs and Reisman, 2006; Boggs and Reisman, 2007). The binding of this enhancer protein to the p53 promoter results in an increased expression of p53 activity as cells enter S-phase in vitro (Boggs and Reisman, 2007). It has also been reported that a negative regulator of p53 transcription, RBP-Jκ (CBF1), can also bind to the same regulatory site upstream of the p53 transcription start site and repress p53 expression (Boggs et al., 2008). It has been hypothesized that a co-ordinated expression of these two transcriptional regulators (C/EBPβ-2 and RBP-Jκ) may, in fact, be responsible for regulating p53 transcription as cells leave G0 and enter S-phase. By incorporating the use of ChIP (chromatin immunoprecipitation) assays, we demonstrate that these two transcriptional regulators play a role in the regulation and expression of p53 in vivo. The results from these studies are consistent with the binding of C/EBPβ-2 and RBP-Jκ to the −972/−953 regulatory element on the p53 promoter regulating the expression of p53 as cells are growth-arrested and stimulated to re-enter the cell cycle and demonstrate a binding pattern that is similar to that seen in vitro in previously published reports (Boggs and Reisman, 2006; Boggs and Reisman, 2007; Boggs et al., 2008). 2. Materials and methods 2.1. Cell lines Swiss3T3 murine fibroblast cells were grown in DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% FBS (fetal bovine serum), 2 mM l-glutamine, 100 units/ml penicillin and 100 μg/ml streptomycin. Cells were cultured at 37°C in a humidified atmosphere of 6% CO2 in air. The cells were grown until they were approx. 80% confluent in three, 15-cm plates per experimental group. For induction of the cell cycle by serum treatment, Swiss3T3 cells were treated with DMEM containing 0.1% FBS for 24 h. The cells were then stimulated to enter S-phase with DMEM containing 15% FBS and collected at the indicated time points after serum stimulation. 2.2. RNA extraction and RT-PCR analysis At indicated time points, serum-treated cultured cells were washed twice with PBS and harvested. RNA was extracted from pelleted cells using the QIAGEN RNeasy protocol. RNA was reverse-transcribed using Ambion RETROscript protocol, and PCR amplifications were performed in a total volume of 50 μl. The samples were subjected to 18 amplification cycles. The sequence of the primers used is as follows: p53 forward 5′-GGAAATTTGTATCCCGAGTATCTG-3′, p53 reverse 5′-GTCTTCCAGTGTGATGATGGTAA-3′, GAPDH (glyceraldehyde-3-phosphate dehydrogenase) forward 5′-AACGGATTTGGCCGTATTGG-3′, GAPDH reverse 5′-CAGAAGGGGCGGAGATGATG-3′. The PCR products were verified by electrophoresis on 2% agarose gels containing ethidium bromide. Pixel-integrated densities were measured using ImageJ software. 2.3. EMSA (electrophoretic mobility-shift assay) Cells were washed twice with cold PBS and lysed on ice with a hypotonic lysis buffer (20 mM Hepes, pH 7.6, 10 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 20% glycerol, 0.1% Triton X-100, 1 mM dithiothreitol, 1 mM PMSF, 1 μg/μl pepstatin and 1 μg/μl aprotinin). Nuclei were resuspended at 2.5×107 nuclei/ml in nuclear extraction buffer (identical with lysis buffer, except with 500 mM NaCl), gently rocked for 1 h at 4°C, centrifuged at 10000 rev./min for 10 min, and supernatant stored at −70°C. The binding reaction consisted of 10 fmol/reaction [γ-32P] ATP end-labelled double-stranded oligonucleotide (−972/−953 binding site on p53:5′ AAGGCATTGGGAAAAAAATA 3′), 2 μg of poly(dI–dC) in binding buffer TM.1 (50 mM Tris/HCl, pH 7.9, 0.1 M KCl, 12.5 mM MgCl2, 1.0 mM EDTA, 20% glycerol and 1 mM dithiothreitol) and incubation on ice for 15 min followed by room temperature incubation for 15 min. The products were separated on a 4% polyacrylamide gel at 4°C in 0.5× TBE (0.045 M Tris borate, 1 mM EDTA). Gels were dried and subjected to autoradiography for 30 min–6 h. To test for specificity, EMSA was performed with unlabelled specific and non-specific competitors ranging from 10- to 50-fold molar excess of the labelled probe. 2.4. ChIP assay The protocol for the ChIP assay was adapted in part from the Farnham lab protocol (http://www.genomecenter.ucdavis.edu/farnham/protocol.html) and the Active Motif ChIP-It™ protocol. 2.4.1. Preparation of blocked Staph A cells Staph A cells were prepared and stored at +4°C. Ten microlitres of 10 mg/ml salmon sperm DNA and 10 μl of 10 mg/ml BSA was added to 100 μl of Staph A aliquots (0.25 μg/μl) and mixed. The Staph A cells were incubated overnight at 4°C on a rotating platform, centrifuged at 14000 rev./min for 3 min at 4°C, and their supernatant was removed. The pellet was resuspended 1 ml 1× DB (dialysis buffer). The Staph A cells were centrifuged at 14000 rev./min for 3 min at 4°C, and the supernatant was removed. The pellet was resuspended in 100 μl of 1× DB with 1 mM PMSF (use 1 μl of 100 mM PMSF). 2.4.2. Preparation of cross-linked cells Swiss 3T3 cells were grown to 80% confluence on three 15-cm plates (per experimental group). The medium was removed, and 20 ml of fixation solution A (1.62 ml of 37% formaldehyde in 60 ml of minimal cell culture medium) was added to the cells. The cells were incubated on a shaking platform for 30 min at 30°C. Fixation solution A was removed, and the cells were washed in 10 ml of 1× PBS. The PBS was removed, and the cells were washed with 2 ml of fresh PBS and pooled into a 15-ml conical tube. The cells were centrifuged for 10 min at 2500 rev./min at 4°C. The pellet was resuspended in 1 ml, ice-cold lysis buffer (supplied with Active Motif ChIP-It™Kit) and was incubated on ice for 30 min. The cells were transferred to an ice-cold Dounce homogenizer and were gently dounced on ice. The nuclei were centrifuged at 5000 rev./min for 10 min at 4°C, the supernatant was removed and the pellet was resuspended in 1 ml of shearing buffer (supplied with Active Motif ChIP-It™Kit). The samples were sonicated using the VirTis VirSonic 50 sonicator. Each sample was sonicated with a 20-s pulse at 25% output power, followed by a 30 s rest on ice. This process was repeated. The sheared chromatin samples were centrifuged at 15000 rev./min at 4°C for 12 min. The supernatant was removed and was stored at −70°C until ready for preclearing. To verify sonication efficiency, 50 μl of the sheared chromatin was added to 150 μl of dH20, 8 μl of 5 M NaCl and 1 μl of RNase. The mixture was incubated for 4 h at 65°C. Two microliters of Proteinase K was added to the mixture and incubated for an additional 1.5 h at 42°C. The sheared chromatin was then verified on a 1% agarose gel containing ethidium bromide. Each sample was sheared into 300- to 700-bp fragments. 2.4.3. Immunoprecipitation of cross-linked chromatin The chromatin was precleared by adding blocked/washed Staph A cells (10 μl per 1×107 cells) and incubated on a rotating platform for 15 min at 4°C. The samples were centrifuged at 14000 rev./min for 5 min at 4°C. The supernatant was equally divided into 1.5-ml siliconized microcentrifuge tubes that represented ∼1×107 cells for each immunoprecipitation. Approx. 1–2 μg of C/EBPβ-2 (Biologend, Cat. No. 622302) or RBP-Jκ (Millipore, Cat. No. AB5790) primary antibody was added to each of the samples. Two micrograms of the non-specific antibody, TIMP3, (Santa Cruz Biotechnology, Cat. No. K1103) was used for the ‘Non-specific Antibody’ negative control. The samples were then incubated on a rotating platform at 4°C overnight. 2.4.3. Washing and cross-link reversal Blocked/washed Staph A cells with PMSF (10 μl per 1×107 cells) were added to the antibody/chromatin samples. The samples were incubated on a rotating platform for 15 min at room temperature and centrifuged at 14000 rev./min for 4 min at 4°C. The supernatant was removed, and the pellets were washed twice with 1 ml of 1× DB that also contained 10 μl of 100 mM PMSF per 1 ml of buffer. The pellets were washed four times with 1 ml of IP (immunoprecipitation) Wash Buffer that also contained 10 μl of 100 mM PMSF per 1 ml of buffer. The antibody/protein/DNA complexes were eluted by adding 50 μl of IP Elution Buffer at room temperature. The samples were placed on a vortexer for 15 min at room temperature and were centrifuged at 14000 rev./min for 3 min at room temperature. The supernatant was removed, and 50 μl of IP Elution Buffer was added to the pellets. The samples were vortexed for 15 min at room temperature, centrifuged, and the supernatant was removed, combining it in the same collection tube (100 μl total). Four microlitres of 5 M NaCl (0.2 M NaCl final) was added to each IP sample. The samples were incubated at 67°C overnight to reverse formaldehyde cross-links. The samples were purified using the Qiagen Qiaquick PCR purification protocol. 2.4.4. PCR of ChIP reactions The samples containing the bound −972/−953 p53 regulatory region and the C/EBPβ-2 or RBP-Jκ protein were PCR-amplified using primers that amplified the regulatory region on the p53 promoter. The forward primer contained a sequence of 5′-AGCGCTGAAGAATTCCTAGAGG-3′, and the reverse primer contained a sequence of 5′-CGAGATACTTGGTATCGCAC-3′. For the ‘Non-specific Primers’ negative control, the forward primer contained a sequence of 5′-CGGTTTCCACCCATTTTGC-3′, and the reverse primer contained the sequence 5′-GGATGCAAACGGAGAGAGCC-3′. Five microlitres of template DNA was used in each PCR reaction. The samples underwent 30 cycles of amplification that included an initial denaturation step at 94°C for 2 min. The remaining 30 cycles alternated between a denaturation step at 94°C for 20 s, an annealing step at 60°C for 45 s and a primer extension step at 72°C for 1 min. 3. Results 3.1. Swiss3T3 p53 mRNA levels increase as cells enter S-phase Exponentially growing Swiss3T3 cells were switched to medium containing 0.1% FBS for 24 h in order to arrest them in G0. These cells were stimulated to re-enter the cell cycle with medium containing 15% FBS. Cells were harvested at indicated time points after serum stimulation, and total RNA was extracted. RT-PCR analysis using p53 and GAPDH primers was performed. The mRNA levels were quantified using the ImageJ, Image Processing and Analysis software that allows one to measure the pixel value of each band in a designated area. Each band was measured using a standard area across all experimental groups. The pixel value was recorded, and all results were normalized to the background of each band. mRNA levels of p53 and GAPDH in exponentially growing Swiss3T3 cells and p53 mRNA levels of cells that were serum starved and subsequently serum stimulated were measured to show the nature of p53 expression as cells are released from G0. Results demonstrated that p53 mRNA levels in cells stimulated to re-enter the cell cycle (synchronized) show an increase upon mitogen induction. p53 mRNA levels in these synchronized cells start to increase significantly between 9 and 12 h after serum stimulation and reached its maximum at 18 h after serum stimulation, whereas the mRNA levels of p53 and GAPDH in exponentially growing cells remained constant (Figure 1). Comparison of the p53 mRNA levels of exponentially growing and synchronized cells indicates that p53 transcript production increases upon mitogen induction as these cells are released from G0. Previous studies have shown that this increase is transient and returns to baseline levels by 24–36 h after serum stimulation (Reich and Levine, 1984; Boggs and Reisman, 2006). 3.2. C/EBPβ-2 binds the −972/−953 regulatory site on p53 in vitro after serum stimulation and entry into S-phase Previous reports have shown that C/EBPβ-2 binds the −972/−953 regulatory site on the p53 gene in vitro and in a cell cycle-dependent manner (Boggs and Reisman, 2007). This binding of C/EBPβ-2 to the p53 regulatory site positively regulates transcription of the p53 gene in a manner that is analogous to the pattern of p53 expression noted as cells are induced to enter S-phase (Boggs and Reisman, 2006; Boggs and Reisman, 2007). EMSAs were performed using nuclear extracts from Swiss3T3 cells (Figure 2A). This assay was performed in order to examine the DNA/protein interaction between C/EBPβ and the −972/−953 regulatory region on the p53 promoter in vitro. These cells were growing either Exp (exponentially), serum depleted for 24 h (0 h) (in order to arrest them in G0) or serum stimulated (so that re-entry into the cell cycle could be obtained) and harvested at 3, 8, 18 or 24 h after serum stimulation. The extracts were tested for the presence of C/EBPβ by adding an anti-C/EBPβ antibody and were then probed with radiolabelled oligonucleotides corresponding to the −972/−953 regulatory region on p53. The addition of the anti-C/EBPβ allowed for binding of the antibody to the C/EBPβ protein to occur. If C/EBPβ is bound to the p53 promoter at its regulatory site, then the addition of the antibody would cause the molecular mass of the complex to increase, causing a supershift that would appear on the gel. The supershifted bands containing the anti-C/EBPβ/protein/DNA complex were quantified using the ImageJ, Image Processing and Analysis software (Figure 2B). The pixel value was recorded, and all results were normalized to the Exp growing cells. The binding of C/EBPβ to p53 was reduced after the cells were serum starved for 24 h (0 h). As the cells were stimulated to re-enter the cell cycle, binding activity of C/EBPβ to the regulatory site on the p53 promoter was increased, with maximal binding at 3 h after serum stimulation (Figure 2). 3.3. C/EBPβ-2 binds the −972/−953 regulatory site on p53 in vivo after serum stimulation and entry into S-phase It is demonstrated here, through the use of ChIP assays, that C/EBPβ-2 binding occurs in vivo in a manner that is similar to the in vitro binding pattern described above. The eluted DNA that was obtained from the reversal of the protein/DNA complexes in the final stages of the ChIP assay was subjected to PCR analysis using primers that were specific to the −972/−953 regulatory site on p53. The resulting PCR products were analysed on a 1% agarose gel containing ethidium bromide (Figure 3A) and reflected a binding pattern that was very similar to the one observed in vitro (Boggs and Reisman, 2007) (Figure 2). After 24 h of serum starvation, C/EBPβ binding to p53 is reduced (0 h). As the cells are released from G0, C/EBPβ binding activity to the regulatory site is greatly increased by 6 h after serum stimulation. It is also shortly after this particular time point within the cell cycle that p53 mRNA levels begin to increase upon serum stimulation (Figure 1). Increased binding of C/EBPβ-2 to the −972/−953 regulatory element of the p53 promoter can be seen as p53 mRNA levels begin to increase (compare Figures 1 and 2). However, as noted previously, C/EBPβ binding activity appears to decrease around 12–24 h after serum stimulation, whereas p53 mRNA levels are at their peak during this time interval. There may be other, yet unidentified factors that modify C/EBPβ binding at this time within the cell cycle and these need to be further studied. 3.4. RBP-Jκ binds the −972/−953 regulatory site on p53 in vitro after serum stimulation and entry into S-phase Previous reports have shown that RBP-Jκ also binds the −972/−953 regulatory site on the p53 gene in vitro and in a cell cycle-dependent manner (Boggs et al., 2008). This binding of RBP-Jκ to the p53 regulatory site negatively regulates transcription of the p53 gene (Boggs et al., 2008). EMSAs were performed using nuclear extracts from Swiss3T3 cells that were growing either Exp or serum depleted for 24 h (0 h) or serum stimulated and harvested at 3, 8, 18 or 24 h postserum stimulation. The extracts were tested for the presence of RBP-Jκ by adding an anti-RBP-Jκ antibody to the binding reaction. The extracts were probed with radiolabelled oligonucleotides corresponding to the −972/−953 regulatory region on p53 (Figure 4A). The supershifted bands containing the anti-RBP-Jκ/protein/DNA complex were quantified using the ImageJ, Image Processing and Analysis software (Figure 4B). Maximal RBP-Jκ binding activity can be seen after cells are serum starved and arrested in G0 (0 h). It is during this time interval in the cell cycle, however, that p53 mRNA levels and C/EBPβ-2 binding are at their lowest (compare Figures 4 and 1). p53 mRNA levels are low as cells are released from growth arrest and do not start to increase until around 6–9 h after serum stimulation. Conversely, it is during this time that RBP-Jκ binding to the p53 regulatory site is at its maximum. As p53 mRNA levels start to increase, RBP-Jκ binding activity to the regulatory site on p53 is consistently decreasing. This is an indication that RBP-Jκ acts as a repressor of p53 transcription, since its binding activity is reduced as cells are released from G0. Another indication of its ability to act as a repressor is due to the fact that the lowest levels of p53 mRNA is noted at a time when RBP-Jκ binding to the p53 promoter is at its greatest. When RBP-Jκ is bound to the p53 promoter, p53 is being repressed as indicated by the gradual decrease in RBP-Jκ/p53 binding activity as the cell cycle progresses and p53 mRNA levels increase (Figure 4). 3.5. RBP-Jκ binds the −972/−953 regulatory site on p53 in vivo after serum stimulation and entry into S-phase It has been demonstrated here, again through the use of ChIP assays, that binding of RBP-Jκ to the p53 regulatory site also occurs in vivo in a manner that reflects the aforementioned in vitro binding pattern. The eluted DNA that was obtained from the reversal of the protein/DNA complexes in the final stages of the ChIP assay was subjected to PCR analysis using primers that were specific to the −972/−953 regulatory site on p53. The resulting PCR reaction, verified on an agarose gel containing ethidium bromide, reflected a binding pattern that was comparable with the one shown in Figure 4 (compare Figure 4 with Figure 5) (Boggs et al., 2008). We previously reported that p53 activity is repressed at various time points throughout the cell cycle as more RBP-Jκ protein is present and that maximal p53 mRNA can be seen around approximately 18 h postserum stimulation when RBP-Jκ protein binding seems to be the lowest (Figures 1 and 4) (Boggs et al., 2008). This is also verified here by the ChIP assays, where the lowest levels of the −972/−953 regulatory region on p53 that is bound to RBP-Jκ is around 12 h after serum stimulation (Figures 5A and 5B). At 12 h postserum stimulation, p53 mRNA levels are increasing, therefore indicating that the more p53 mRNA that is available, the less RBP-Jκ protein is bound. Also, maximal binding of RBP-Jκ to the regulatory site on p53 is at the interval when cells are being released from G0 at a time when p53 transcripts are at their lowest. This supports the conclusion that levels of p53 transcripts are being repressed by increasing amounts of RBP-Jκ protein present throughout the cell cycle (Figure 5B). RBP-Jκ binds to the regulatory site on the p53 promoter most abundantly when cells are in G1 and express low p53 mRNA. 4. Discussion The results from these experiments provide further verification that supports and enhances previously published reports indicating that at least two transcriptional regulatory proteins bind to the −972/−953 regulatory region on the p53 gene and play two very different roles in regulating transcription of this important tumour suppressor. C/EBPβ-2 serves to enhance p53 transcription during the transition from the growth-arrested state to the entry into S-phase, while RBP-Jκ serves to repress p53 transcription during this transition. These results suggest that both factors (C/EBPβ-2 and RBP-Jκ) may work co-operatively or in a co-ordinated manner to help regulate the activity of p53 throughout the cell cycle. Although it has been previously reported over 20 years ago that the p53 gene is induced upon mitogenic stimulation in mouse fibroblast cells, the molecular mechanisms as to how this occurs has yet to be explained (Reich and Levine, 1984). Increases in p53 protein levels could lead to apoptosis or growth arrest, although p53 protein levels remain low under normal conditions. However, there is a peak in its transcription prior to S-phase. This increase in transcription prior to DNA synthesis may serve as a mechanism to ensure rapid p53-induced growth arrest in response to DNA damage. Preventing the replication of damaged DNA by rapid induction of p53 is very important, since replication of damaged DNA can lead to genetic instability and possibly cancer. Therefore, a proper understanding of how p53 transcription is regulated is of ultimate importance as aberrations in this response could contribute to oncogenesis. Endogenous p53 mRNA levels are reduced in cells that have undergone serum depletion for 24 h and are arrested in G0. Upon serum stimulation, p53 mRNA levels begin to increase at approx. 9 h after serum stimulation with the greatest levels seen between 12 and 18 h postserum stimulation. Here, we have verified previous reports that show in vitro differential binding of factors to the −972/−953 regulatory region on the p53 promoter during the cell cycle by demonstrating that these results occur in a comparable manner in vivo. While in vitro DNA binding assays support the cell cycle regulation by C/EBPβ, until now, without evidence of binding in vivo to chromatin, these conclusions remained tentative. Here, it is demonstrated in vivo that the greatest binding activity of C/EBPβ to the −972/−953 regulatory site on the p53 gene is at its highest at approx. 6 h after serum stimulation (Figures 3A and 3B) when p53 mRNA levels are being increased in the cell cycle (Figure 1). This supports the conclusion that C/EBPβ-2 protein is positively regulating p53 transcription. This is consistent with transfection studies where C/EBPβ-2 enhances expression of the p53 promoter, as well as, that higher levels of p53 transcripts are seen soon after C/EBPβ-2 protein bound to the p53 promoter (compare Figure 3 to Figure 1). As seen in Figure 3, binding of C/EBPβ was reduced after 24 h of serum depletion and increased at 3 h after serum stimulation. The binding activity of C/EBPβ to the regulatory region upstream of the p53 transcription start site mirrors the mRNA levels of p53 throughout the cell cycle. C/EBPβ is regulated post-transcriptionally and plays a variety of roles in different tissue types (Ewing et al., 2008), possibly explaining why its binding activity to the −972/−953 regulatory site decreases around 12 h after serum stimulation, even though p53 mRNA levels are on the rise at this particular time point. Conversely, the opposite pattern is observed upon the binding of RBP-Jκ to the p53 promoter. As seen in Figure 5(B), binding of RBP-Jκ to the p53 promoter is reduced by 3 h after serum stimulation after which p53 mRNA levels start to increase. p53 mRNA levels peak around 18 h after serum stimulation when RBP-Jκ binding activity is low. Therefore, greater binding activity of RBP-Jκ to the regulatory region reflects lower p53 mRNA levels. In combination, these results indicate that C/EBPβ likely enhances the transcription of p53, whereas RBP-Jκ represses it, due to analogous representations of co-ordinated levels of binding activity and p53 mRNA levels. A recent publication by Soto-Reyes and Recillas-Targa (2010) demonstrated that p53 regulation can also occur at the epigenetic level. Their findings demonstrated that the transcription factor, CTCF, a zinc-finger nuclear factor that binds the CCCTC sequence, binds to a region upstream of the p53 transcription start site and is involved in maintaining its expression (Soto-Reyes and Recillas-Targa, 2010). According to their results, in the absence of CTCF, repressive hypermethylated histone marks, such as H4K20me3, H3K9me3 and H3K27me3, are attracted to the p53 promoter and subsequently silence its expression through epigenetic modifications (Soto-Reyes and Recillas-Targa, 2010). Their evidence suggests that CTCF protects the p53 promoter from epigenetic modifications by blocking the incorporation of these hypermethylated histone marks (Soto-Reyes and Recillas-Targa, 2010). C/EBPβ is a CCAAT enhancer-binding protein that is a member of the bZIP (basic leucine zipper transcription factor) family that plays an important role in mediating cell proliferation, differentiation and, in some cell types, is also involved in inflammatory responses, metabolism, cellular transformation, oncogene-induced senescence and tumorigenesis (Ewing et al., 2008). Studies have been performed that show that C/EBPβ knockout mice have immunological defects, homoeostasic glucose alterations, are prone to develop lymphoproliferative disorders and also have defects in female reproduction and infertility (Screpanti et al., 1995; Chen et al., 1997; Croniger et al., 1997; Sterneck et al., 1997; Tanaka et al., 1995). C/EBPβ participates in such a wide variety of biological functions, suggesting that it is possibly under the control of multiple forms of regulation. C/EBPβ binds the p53 promoter in exponentially growing Swiss3T3 murine fibroblasts cells and plays a role in the regulation of p53 transcription after serum depletion and subsequent serum stimulation in vitro and in vivo. As mentioned earlier, C/EBPβ binding to the −972/−953 regulatory region of the p53 promoter increases substantially 3 h after serum stimulation and continues to increase approx. 6 h after serum stimulation. This pattern of binding coincides with the increase in p53 mRNA levels that is observed. This binding pattern indicates that C/EBPβ participates in regulating p53 promoter activity in S-phase. The binding of C/EBPβ and RBP-Jκ to the p53 promoter is transient. The results indicate that the binding activity of C/EBPβ is greatest between 3 and 6 h after serum stimulation and slightly decrease and subsequently increase throughout the remainder of the cell cycle (Figure 3B). It is possible that other, yet unidentified factors are also playing a role in the regulation of p53 transcription that may explain the decreased binding activity of C/EBPβ at approx. 12 h after serum stimulation. It is also possible that modifications to the C/EBPβ protein may be occurring that interfere with its binding to p53 at this time in the cell cycle. Any additional factors contributing to the regulation of p53 transcription at later stages in the cell cycle need to be further elucidated in order to fully understand the molecular mechanisms of transcription. It is also plausible that some of the cells experience a loss of synchronization later in the cell cycle, thus possibly explaining the decrease in binding activity later in the cell cycle at approx. 12 h after serum stimulation. RBP-Jκ is the mammalian homolog of Drosophila Suppressor of Hairless (Schweisguth and Posokony, 1992; Kato et al., 1997; Miele, 2006; Tani et al., 2001). This protein participates in the transcriptional regulation of target genes by interacting with the cytoplasmic domain of the Notch receptors (Schweisguth and Posokony, 1992; Kato et al., 1997; Miele, 2006; Tani et al., 2001). Previous studies have reported that RBP-Jκ exists in a complex with the Notch receptor and, upon ligand binding, is released to enter the nucleus (Miele, 2006). When RBP-Jκ is released, transcriptional repression of its target genes occurs through the recruitment of co-repressor complexes and prevents transcription from occurring (Oswald et al., 2005; Olave et al., 1997). Both RBP-Jκ and the Notch pathway have been implicated in many different developmental and regulatory signalling pathways that involve the determination of a cell's fate, neurogenesis, myogenesis, B and T cell formation, haematopoesis and B cell transformation by Epstein–Barr virus (Grossman et al., 1994; Hsieh and Hayward, 1995; Kato et al., 1997; Tanigaki et al., 2003; Robert-Moreno et al., 2005; Buono et al., 2006). Previous studies have shown that RBP-Jκ and C/EBPβ not only bind to an overlapping region on the p53 promoter, but also bind to the same region on the IL-6 (interleukin-6) promoter, leading to the co-operation of these two factors in the expression of IL-6 (Vales and Friedl, 2002). Our reports, here and previously published, show that repression of p53 by RBP-Jκ and activation of p53 by C/EBPβ, through differential binding of these two factors, plays a role in the expression of p53 in the cell cycle, since both factors bind to the same region on the p53 promoter, indicating that some sort of co-ordination between the two factors is occurring in the regulation of p53 transcription. Although these results and ones previously published (Boggs and Reisman, 2006; Boggs and Reisman, 2007; Boggs et al., 2008) demonstrate two factors that possibly work to influence the expression and regulation of p53 throughout the cell cycle, additional research is needed to fully understand the reason for the induction of p53 as cells enter S-phase. The accumulation of p53 transcripts prior to S-phase may serve as a rapid p53-induced growth arrest and/or apoptosis of the cell in response to DNA damage. Other studies which evaluate the contribution of known co-repressors, such as SMRT, HDAC1 and others (Beatus, et al, 2001) and also incorporating the use of siRNA (small interfering RNAs) would be useful in elucidating the roles of C/EBPβ and RBP-Jκ and the roles they play in regulating p53 expression. These studies would be important because it would allow one to see how p53 expression is regulated if these two factors are inhibited, and binding to the −972/−953 regulatory region on the p53 promoter is hindered. Also, since C/EBPβ plays such as varied role in multiple tissue types, it may be of some importance to see if there are any post-translation modifications made to the protein that could possibly influence how it carries out its mechanism of action in different cell/tissue types. The wealth of information that could be obtained from these and other studies pertaining to the regulation and expression of p53 could play a tremendous role in the understanding of how these factors contribute to oncogenesis. Author contribution Amanda Polson designed and performed most of the experiments, analysed data and wrote the manuscript. Paula Takahashi designed and performed some specific experiments and wrote a portion of the manuscript. David Reisman established the rationale and background data for the project, designed experiments, analysed data and contributed to writing of the manuscript. Acknowledgements We would like to thank Dr Kristy Boggs for her many contributions and the Farnham Laboratory from UC Davis for providing us with a detailed protocol for the ChIP assays. Funding This work was supported by grants from the REFERENCES An, WG, Kanekal, M, Simon, M, Maltepe, E, Blagosklonny, M and Neckers, L (1998) Stabilization of wild-type p53 by hypoxia-inducible factor 1 alpha. Nature 392, 405-8 Bates, S (1998) p14ARF links the tumor suppressors Rb and p53. Nature 395, 124-5 Beatus, P, Lundkvist, J, Oberg, C, Pedersen, K and Lendahl, U (2001) The origin of the ankyrin repeat region in Notch intracellular domains is critical for regulation of HES promoter activity. Mech Dev 104, 3-20 Boggs, K and Reisman, D (2006) Increased p53 transcription prior to DNA synthesis is regulated through a novel regulatory element within the p53 promoter. Oncogene 00, 1-12 Boggs, K and Reisman, D (2007) C/EBPβ participates in regulating transcription of the p53 gene in response to mitogen stimulation. J Biol Chem 282, 7982-90 Boggs, K, Henderson, B and Reisman, D (2008) RBP-Jκ binds to and represses transcription of the p53 tumor suppressor gene. Cell Biol Int 33, 318-24 Buono, K, Robinson, G, Martin, C, Shi, S, Stanley, P and Tanigaki, K (2006) The canonical Notch/Rbp-J signaling pathway controls the balance of cell lineages in mammary epithelium during pregnancy. Dev Biol 293, 565-80 Chen, X, Ko, L, Jayaraman, L and Prives, C (1996) p53 levels, functional domains, and DNA damage determine the extent of the apoptotic response of tumor cells. Genes Dev 19, 2438-51 Chen, X, Liu, W, Ambrosino, C, Ruocco, MR, Poli, V, Romani, L, Quinto, I, Barbieri, S, Holmes, KL, Venuta, S and Scala, G (1997) Impaired generation of bone marrow B lymphocytes in mice deficient in C/EBPbeta. Blood 90, 156-64 Croniger, C, Trus, M, Lysek-Stupp, K, Cohen, H, Liu, Y, Darlington, GJ, Poli, V, Hanson, RW and Reshef, L (1997) Role of the isoforms of CCAAT/enhancer-binding protein in the initiation of phosphoenolpyruvate carboxykinase (GTP) gene transcription at birth. J Biol Chem 272, 26306-12 Ewing, SJ, Zhu, S, Zhu, F, House, JS and Smart, RC (2008) C/EBPbeta represses p53 to promote cell survival downstream of DNA damage independent of oncogenic Ras and p19Arf. Cell Death Differ 15, 1734-44 Hsieh, JJD and Hayward, SD (1995) Masking of the CBF1/RBPJk transcriptional regulation domain by Epstein–Barr virus EBNA2. Science 268, 560-3 Grossman, SR, Johannsen, E, Tong, X, Yalamanchili, R and Kieff, E (1994) The Epstein–Barr virus nuclear antigen 2 transactivator is directed to response elements by the Jk recombination signal sequence binding protein. Proc Natl Acad Sci USA 91, 7568 Kato, H, Taniguchi, Y, Kurooka, H, Minoguchi, S, Sakai, T and Nomura-Okazaki, T (1997) Involvement of RBP-J in biological functions of mouse Notch1 and its derivatives. Development 124, 4133-41 Khoo, K, Mayer, S and Fersht, AR (2009) Effects of stability on the biological function of p53. J Biol Chem 284, 30974-80 Miele, L (2006) Notch signaling. Clin Cancer Res 12, 1074-9 Olave, I, Reinberg, D and Vales, LD (1997) The mammalian transcriptional repressor RBP (CBF1) targets TFIID and TFIIA to prevent activated transcription. Genes Dev 12, 1621-37 Oswald, F, Winkler, M, Cao, Y, Astrahantseff, K, Bourteele, S, Knochel, W and Borggrefe, T (2005) RBP-Jkappa/SHARP recruits CtIP/CtBP corepressors to silence Notch target genes. Mol Cell Biol 25, 10379-90 Reich, NC and Levine, AJ (1984) Growth regulation of a cellular tumor antigen, p53, in non-transformed cells. Nature 308, 199-201 Robert-Moreno, A, Espinosa, L, de la Pompa, JL, and Bigas, A (2005) RBPjkappa-dependent Notch function regulates Gata2 and is essential for the formation of intra-embryonic hematopoietic cells. Development 132, 1117-26 Schweisguth, S and Posokony, JW (1992) Suppressor of hairless, the Drosophila homolog of the mouse recombination signal-binding protein gene, controls sensory organ fate cells. Cell 69, 1199-212 Screpanti, I, Romani, L, Musiani, P, Modesti, A, Fattori, E, Lazzaro, K, Sellitto, C, Scarpa, S, Bellavia, D and Lattanzio, G (1995) Lymphoproliferative disorder and imbalanced T-helper response in C/EBP beta-deficient mice. EMBO J 14, 1932-41 Sharpless, NE and DePinho, RA (2002) p53: good cop/bad cop. Cell 110, 9-12 Sterneck, E, Tessarollo, L and Johnson, PF (1997) An essential role for C/EBPbeta in female reproduction. Genes Dev 11, 2153-62 Soto-Reyes, E and Recillas-Targa, F (2010) Epigenetic regulation of the human p53 gene promoter by the CTCF transcription factor in transformed cell lines. Oncogene 29, (15), 2217-27 Takaoka, A, Hayakawa, S, Yanai, H, Stoiber, D, Negishi, H, Kikuchi, H, Sasaki, S, Imai, K, Shibue, T, Honda, K and Taniguchi, T (2003) Integration of interferon-alpha/beta signaling to p53 responses in tumor suppression and antiviral defense. Nature 242, 516-23 Tanaka, T, Akira, S, Yoshida, K, Umemoto, MM, Yoneda, Y, Shirafuji, N, Fujiwara, H, Suematsu, S, Yoshida, N and Kishimoto, T (1995) Targeted disruption of the NF-IL6 gene discloses its essential role in bacteria killing and tumor cytotoxicity by macrophages. Cell 80, 353-61 Tani, S, Kurooka, H, Aoki, A, Hashmoto, N and Honjo, T (2001) The N- and C-terminal regions of RBP-J interact with the ankyrin repeats of Notch1 RAMIC to activate transcription. Nucleic Acids Res 29, 1373-80 Tanigaki, K, Kuroda, K, Han, H and Honjo, T (2003) Regulation of B cell development by Notch/RPB J signaling. Semin Immunol 15, 113-9 Toyoshima, M (2009) Analysis of p53 Dependent damage response in sperm-irradiated mouse embryos. J Radiat Res 50, 11-7 Vales, L and Friedl, E (2002) Binding of C/EBP and RBP (CBF1) to overlapping sites regulates interleukin-6 gene expression. J Biol Chem 277, 42438e46 Vogelstein, B, Lane, D and Levine, AJ (2000) Surfing the p53 network. Nature 408, 307-10 Vousden, KH and Lu, X (2002) Live or let die: the cell's response to p53. Nat Rev 2, 594-604 Weinberg, R (2007) The biology of cancer. p. 796, Garland Science, Taylor & Francis Group, LLC, New York, New York Zhao, Y, Chen, XQ and Du, JZ (2009 May) Cellular adaptation to hypoxia and p53 transcription regulation. J Zhejiang Univ Sci 10, (5), 404-10 Received 15 November 2009/3 April 2010; accepted 7 May 2010 Published as Cell Biology International Immediate Publication 7 May 2010, doi:10.1042/CBI20090401 © The Author(s) Journal compilation © 2010 Portland Press Limited |
ISSN Print: 1065-6995
ISSN Electronic: 1095-8355 Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB) |