Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2010) 34, 979–984 (Printed in Great Britain)
Changes in the expression pattern of mesenchymal and pluripotent markers in human adipose-derived stem cells
Eulsoon Park*‡ and Amit N Patel†1
*Department of Bioengineering, Swanson School of Engineering, University of Pittsburgh, 300 Technology Drive, Pittsburgh, PA 15219, U.S.A., †Division of Cardiothoracic Surgery, University of Utah, SOM 3C127, 30 North 1900 East, Salt Lake City, UT 84132, U.S.A., and ‡Department of Bioengineering, Nagaoka University of Technology, 16031 Kamitomioka, Nagaoka, Niigata 9402188, Japan


Pluripotent marker genes encode transcription factors that suppress differentiation and allow stem cells to continue proliferation while remaining poised to develop into cells from multiple lineages. Mesenchymal marker proteins are widely used to identify and characterize multipotent stem cells that are capable of differentiation into cells of the mesenchymal lineage. We examine here the expression pattern of mesenchymal and pluripotent markers in ADSCs (human adipose-derived stem cells) during culture. Flow cytometry indicates that a large fraction of ADSCs were positive for multiple mesenchymal markers, such as CD29, CD44 and CD90. The expression levels of these markers increase and become more uniform in cells that are cultured for long periods. Alternatively, mRNAs for several pluripotent genes, such as Nanog, Oct-4 and Rex-1, are detected only in cells from early passages. In addition, ADSCs cultured over long periods express several cardiac genes in response to serum deprivation and treatment with phorbol ester. Thus, these data demonstrate that ADSCs expanded in culture over multiple passages consistently express mesenchymal markers with the ability to differentiate towards the cardiac lineage.


Key words: human adipose-derived stem cell, mesenchymal marker, pluripotent marker gene

Abbreviations: ADSCs, human adipose-derived stem cells, DAPI, 4′,6-diamidino-2-phenylindole, dihydrochloride, PKC, protein kinase C, PMA, phorbol myristate acetate

1To whom correspondence should be addressed (email amit.patel@hsc.utah.edu).


1. Introduction

Mesenchymal stem cells are multipotent cells in the adult body that can be induced to differentiate towards a variety of cell types, including skeletal muscle, smooth muscle and cardiac myocytes (Katz et al., 2005; Strem et al., 2005). These cells are often called stromal cells, indicating that they reside in the connective tissue and do not possess discernible differentiated phenotypes (Zuk et al., 2002). Several cell surface markers, such as Stro-1, CD29, CD44 and CD90, are known to be expressed by mesenchymal stem cells (Romanov et al., 2003). These cell surface markers are widely used for the identification and characterization of less committed cells in adult tissue. However, mesenchymal marker proteins by themselves are not considered to play any role in the maintenance of multipotency (Ulloa-Montoya et al., 2007). This is in striking contrast to pluripotent marker proteins, which are transcription factors and confer pluripotency in adult cells. Therefore, mesenchymal markers may not represent the true differentiation potential of adult-origin stem cells.

ADSCs (adipose-derived stem cells) are attractive for patient-oriented cell therapy because of their relative abundance and the ease with which they can be obtained (Gimble et al., 2007). Previous studies have shown that ADSCs express several mesenchymal markers, such as CD29, CD44 and CD90 (Prockop et al., 2001; Bieback et al., 2004; Katz et al., 2005). Yet, only a small fraction of these cells appeared to exhibit differentiated phenotypes upon treatment with drugs and growth factors (Arai et al., 1997; Rydén et al., 2003). For example, a very small number of spontaneously beating cardiomyocyte-like cells were obtained following treatment of ADSCs with 5-azacytidine. Furthermore, the induction of differentiated phenotypes usually requires cells to be maintained in culture for an extended period of time (Rodríguez et al., 2006). These observations indicate that ADSCs contain heterogeneous populations, of which a small percentage possesses the full potential for differentiation into cardiomyogenic lineage.

Thus, we questioned whether mesenchymal marker expression represents the true differentiation capacity of ADSCs. In this study, we used human ADSCs cultured for various periods of time to examine the changes in expression of mesenchymal and pluripotent markers. This paper reports that mesenchymal markers increase during culture, whereas the expression of pluripotent genes rapidly declines. This observation raises the issue of how closely multipotent stem cells from adult tissue resemble pluripotent stem cells. In the present study, we examine the relationship of the capacity for stem cell differentiation and the expression of mesenchymal and pluripotent markers.

2. Materials and methods

2.1. Adipose-derived stem cells

ADSCs derived from two sources were used in this study. One was prepared in our laboratory, and the other was purchased from a commercial provider. For the cells prepared in our laboratory, subcutaneous adipose tissue was harvested from three individual patients during elective abdominoplasty. The subcutaneous adipose tissue was minced and then digested in Hank's balanced salt solution containing 1 mg/ml type II collagenase and 3.5% fatty acid-free BSA in a shaking water bath at 37°C until the mixture was homogeneous. The digested tissue was then filtered through double-layered gauze (350 μm) and centrifuged at 1000 rev./min for 10 min. After centrifugation, the resulted pellet was treated with erythrocyte lysis buffer, vortexed and centrifuged at 1000 rev./min for 10 min. The cells were resuspended in standard cell culture medium [DMEM (Dulbecco's modified Eagle's medium)/F12 50:50, supplemented with 10% FBS (fetal bovine serum) and antibiotics], plated at a density of 5×103 cells/cm2 and cultured at 37°C under a 5% CO2 atmosphere. Cell culture media was changed every 2 days until confluence. The cells attached to the culture dish after initial isolation were designated as passage 0. ADSCs from a commercial source (ScienCell Research Laboratories) were also used in this project. The frozen stock provided by the company was designated as passage 1. According to the company, these cells were obtained using a procedure similar to ours. Informed consent was obtained from all subjects, and all studies were conducted with strict adherence to guidelines of the Institutional Review Board of University of Pittsburgh.

2.2. Flow cytometry

ADSCs were harvested and analysed for mesenchymal marker expression using a FACS (Becton Dickinson). Briefly, harvested cells were probed with monoclonal antibodies against human CD44 (Invitrogen), CD29 (Chemicon), CD90 (Invitrogen), CD34 (Chemicon) or CD45 (Abcam). Following incubation with the primary antibody, cells were labelled with goat anti-mouse IgG conjugated Alexa Fluor-488 (Molecular Probes, Invitrogen). Analysis was performed on ∼500000 cells per sample, and positive expression was defined as a level of fluorescence greater than 99% of the corresponding cell sample without primary antibody.

2.3. RT-PCR

Total RNA was extracted from ADSCs using the RNeasy Mini RNA extraction kit (Qiagen Inc.) according to the manufacturer's protocol. The quality of the extracted RNA was evaluated with OD (optical density), and the absorbance ratio (260:280 nm) was consistently in the range between 1.7 and 1.9 for each preparation. Human heart total RNA was obtained from a commercial source (Ambion) and was used as a positive control. First-strand cDNA was synthesized from a total of 1 μg of RNA with Thermostable Reverse Transcriptase (Thermoscript, Invitrogen) using oligod(T)20. Complementary DNA samples were subjected to PCR amplification with primers for pluripotent markers, cardiac-specific genes and housekeeping genes (Table 1). PCR reactions were performed with 0.2–2 μl of cDNA template using a commercially available premixed solution (GenChoice) in a 25-μl volume. Standard PCR was performed at 30 cycles each consisting of 94°C for 5 s, 58°C or 62°C for 5 s and 72°C for 30 s with a final extension at 72°C for 4 min. The PCR products were size-fractionated by electrophoresis in a 2% agarose gel.


Table 1 Primers used in RT-PCR

Name GenBank® accession number Direction Primer sequence (5′→3′) Position (bp) Melting temperature (°C) Length (bp)
Cardiogenic
GAPDH NM_002046.3 Forward GTCAACGGATTTGGTCGTATTG 124–262 58 139
Reverse CATGGGTGGAATCATATTGGAA
GATA-4 NM_002052.2 Forward TCCCTCTTCCCTCCTCAAAT 1851–2044 58 193
Reverse TCAGCGTGTAAAGGCATCTG
Nkx2.5 NM_004387.2 Forward AGCCCTGGCTACAGCTGCA 969–1230 62 262
Reverse TGGGAGCCCCTTCTCCCC
Mef2C NM_002397.2 Forward AGTGGTTTCCGTAGCAACTCCT 1283–1512 62 228
Reverse TAGTGCAAGCTCCCAACTGACT
α-Cardiac actin NM_005159.3 Forward TCTATGAGGGCTACGCTTTG 677–936 58 260
Reverse GCCAATAGTGATGACTTGGC
Troponin-T NM_000364.2 Forward AGAGCGGAAAAGTGGGAAGA 672–906 58 235
Reverse CTGGTTATCGTTGATCCTGT
Beta-myosin heavy chain (βMHC) NM_000257.1 Forward CGAGGCAAGCTCACCTACAC 3993–4311 62 319
Reverse CATTAACAGCCTCCACGGCC
Connexin43 NM_000165.2 Forward CAAGGTTGCCCAAACTGATGGT 546–791 62 244
Reverse TGATGTGGGCAGGGATCTCTTT
Pluripotent
Oct-4 NM_203289.2 Forward GGGGTTCTATTTGGGAAGGTA 330–699 62 370
Reverse GTTGTGCATAGTCGCTGCTTGA
Rex1 NM_174900.3 Forward GGAATGTGGGAAAGCGTTCGTT 1068–1310 62 241
Reverse TTTGCATGCGTTAGGATGTGGG
Nanog NM_024865.1 Forward ATAGCAATGGTGTGACGCA 698–916 58 217
Reverse GATTGTTCCAGGATTGGGTG



The gels were stained with ethidium bromide, and signals were detected and quantified using a CCD (charge-coupled device) camera-based instrument (UVP). For semiquantitative measurement, various cycle numbers and amounts of cDNA were used to test the linearity of the PCRs. The level of mRNA was estimated from data that were in the linear range with respect to the amount of cDNA used. Levels of cardiac mRNAs were normalized using GAPDH mRNA.

2.4. Immunofluorescence staining

Cells were washed once with ice-cold PBS and fixed with 4% paraformaldehyde for 15 min at room temperature. After washing twice with PBS, fixed cells were incubated with PBS supplemented with 0.1% Triton-X for 15 min, and then non-specific binding was blocked using normal goat serum. Monoclonal antibodies for cardiac actin (Biodesign International) and troponin T/I (Biomedia) were applied at 4°C overnight. Cells were washed with PBS, followed by incubation with secondary antibody tagged with the fluorescent dye Alexa Fluor-488 (Invitrogen) for 1 h. After subsequent washes with PBS, stained cells were viewed by fluorescent microscopy (Olympus Provis, OLYMPUS Optical Co., Ltd). To provide a quick assessment of cell distribution, DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride; 0.6 μg/ml) was used to stain the nuclei of the cells.

2.5. Statistical analysis

We used ADSCs from both sources at passage numbers between 7 and 11 for the measurement of cardiac gene expression in response to serum removal and PMA (phorbol myristate acetate) treatment. We used an RNA sample from ADSCs cultured in the presence of 10% FBS to obtain control levels of cardiac mRNAs. Statistical analysis was performed by t test with P<0.05 as the threshold for statistical significance.

3. Results

3.1. Morphology and karyotypes

We used human ADSCs derived from two different sources for our experiments. The first was established in our laboratory (ADSC1), and the other was obtained from a commercial source (ADSC2). Supplementary Figure S1(A) (at http://www.cellbiolint.org/cbi/034/cbi0340979add.htm) shows a phase contrast image of ADSC1 cells at passage 4. The majority of cells in this preparation exhibited multiple extensions from a relatively round cell body, whereas a small number of cells (less than 5%) possessed a flat and extended cell body with shorter and less obvious extensions. Almost all ADSC2 cells were morphologically identical to the rounded ADSC1 cells, with a very small number of flat cells (<1%). We detected no apparent morphological changes in either population of ADSCs cultured over 20 passages. Karyotype analysis of ADSCs from the two preparations at passages 4 and 5 demonstrated a normal female karyotype of 46 chromosomes with no aneuploidy, tetraploidy or other visible abnormalities (Supplementary Figure S1B for ADSC1, data not shown for ADSC2). ADSC1 cells appeared to have a doubling time of ∼1.6 days in the standard medium containing 10% FBS, whereas ADSC2 cells proliferated at a slightly slower rate, with a doubling time of ∼2.4 days.

3.2. Expression of mesenchymal markers in ADSCs

Human ADSCs are known to express several mesenchymal marker proteins at the time of preparation from adipose tissues. However, it was unclear whether these cells maintain the expression of mesenchymal markers during extended culture. We used flow cytometry to examine the expression of these surface markers at various passages. As expected, a large fraction of ADSCs from early passages were positive for the mesenchymal cell markers CD29, CD34, CD44 and CD90 (Figure 1 for ADSC1). The portion of cells positive for these markers increased as the culture passages progressed. Moreover, the peak positions for these markers were shifted to the right with concomitant sharpening of the distribution pattern. These observations indicate that ADSCs become more uniform with higher expression of mesenchymal markers during culture. However, ADSCs maintained in culture for an extended period of time also developed minor peaks on the left side of the cytometry profiles, which might represent dying or damaged cells. Cells from these late passages also expressed CD45, which is a marker of the haematopoietic lineage. Because CD45 was seen in a large portion of ADSCs at passage 20, it can be assumed that the majority of these cells must express both mesenchymal and haematopoietic markers. ADSC2s showed a similar pattern of increased expression of mesenchymal markers with a sharpening of the peak and the appearance of CD45 expression in late passages (data not shown for ADSC2). Thus, ADSCs sustain and increase expression of multiple mesenchymal markers during culture and begin to undergo changes, during which we believe the cells progress towards pure mesenchymal stem cells.

3.3. Expression of pluripotent marker genes in ADSCs

Although mesenchymal markers are commonly used to identify multipotent adult cells, they are not considered to play any direct role in the maintenance of multipotency. In contrast, pluripotent transcription factors are capable of transforming some types of adult cells into stem cells. We found that ADSCs cultured for a short period of time express mRNAs for several pluripotent markers. RT-PCR revealed that ADSC1 cells expressed significant levels of mRNA for Nanog, Oct-4 and Rex-1 (Figure 2). In ADSC2 cells, we detected mRNA for Nanog and Rex-1, but failed to detect mRNA for Oct-4; data not shown). In both preparations, the expression levels of pluripotent marker mRNAs were decreased as the passages progressed. Thus, ADSC preparations appear to contain several pluripotent transcription factors, but rapidly lose their expression during extended culture.

3.4. The induction of cardiac mRNAs by serum removal and activation of PKC (protein kinase C) in ADSCs

Several studies have shown that ADSCs can be differentiated towards cardiomyocyte-like cells (Passier et al., 2005; Pal and Khanna, 2007; van Dijk et al., 2008). Since ADSC1s at passage 7 showed high expression levels of mesenchymal markers, we used cells from passages at 7–11 to test the capacity of various culture conditions and pharmacological agents to induce cardiomyogenic differentiation of ADSCs. ADSCs cultured in standard growth medium with 10% FBS expressed detectable mRNAs for cardiac actin, GATA4, Mef2C and connexin43 at variable levels. We found that serum removal and treatment with the PKC activator, PMA, increased the mRNA levels of many cardiomyogenic genes. Transient activation of PKC for 24 h appeared to be sufficient to promote the increased expression of several cardiac mRNAs for up to 8 days (data not shown). Figure 3 shows the results obtained with ADSCs treated with 10 nM PMA or vehicle in the absence of serum (0.1% BSA) for 24 h and then cultured for four additional days in serum-free medium alone. RT-PCR indicated that PMA treatment significantly increased mRNA levels of cardiac actin, Mef2C and troponin T (Figure 3). In addition, activation of PKC with PMA increased the level of Nkx2.5 mRNA. However, we failed to detect mRNAs for β-myosin heavy chain or for the atrial or ventricular isoforms of myosin light chains in PMA-treated or control cells. Moreover, no apparent morphological changes or spontaneous beating were observed in PMA-treated ADSCs. Thus, activation of PKC increases the expression of several cardiomyogenic genes in ADSCs cultured for an extended period without the appearance of a well-differentiated cardiomyocyte phenotype.

3.5. The induction of cardiac proteins by serum removal and activation of PKC occurs in a large population of ADSCs

It was possible that the detected increase in cardiac mRNAs might have occured only in a small population of cells. Therefore, we utilized immunostaining of ADSCs to determine what percentage of the cell population expressed these cardiomyogenic genes. Immunostaining with antibodies against cardiac actin and troponin revealed fibre-like structures, reminiscent of cytoskeleton (Figure 4). These staining patterns were observed throughout both ADSC populations under all culture conditions. If only a small population of cells had differentiated to express cardiac genes, then the variability in staining intensity would be larger in PMA-treated ADSCs than in control vehicle-treated cells. However, we observed no obvious difference in the staining variability between vehicle-treated and PMA-treated ADSCs. These observations suggest that serum removal and activation of PKC enhanced cardiac gene expression in the entire population of ADSCs. Taken together, these findings indicate that the induction of cardiomyogenic gene expression by PKC activation occurs in mesenchymal marker-positive human ADSCs in culture.

4. Discussion

ADSCs have gained much attention as an abundant source of autologous regenerative cells for patients with heart diseases (Gimble et al., 2007). Yet, successful in vitro differentiation of ADSCs into beating myocytes has been limited to a tiny fraction of these cells (Lee et al., 2009). In this study, we show that ADSCs maintain stable expression of mesenchymal cell markers and respond to serum deprivation and activation of PKC in culture without any apparent morphological changes. In contrast, the expression levels of mRNAs for several pluripotent transcription factors decline significantly after serial passages. Thus, mesenchymal marker-positive ADSCs can be expanded in culture without significant alteration of their biological properties. However, these mesenchymal marker-positive ADSCs exhibited only moderate increases in some cardiogenic genes without clear morphological and functional changes. Therefore, they may possess only limited capacity to differentiate towards cardiomyogenic lineages.

One of the potential problems associated with the use of patient-oriented ADSCs is the variability in age, sex and pathological and physiological status of patients (Gimble et al., 2007). These differences can have a significant influence on differentiation in culture and in vivo (Lee et al., 2009). This study used ADSCs from two different sources. A large portion of cells in the two preparations exhibited similar morphology and mesenchymal surface marker expression. Furthermore, both preparations maintained expression of these markers over many passages. These observations suggest that mesenchymal marker-positive ADSCs with identical properties comprise the majority of the cell populations used in our study, even though they were derived from two different sources.

Our data also indicate that the expression of mesenchymal markers in ADSCs increased as the passage number increased. In addition, the major peak observed in flow cytometry analysis became sharper as the passages progressed, suggesting that ADSCs at later passages are more uniform in terms of mesenchymal marker expression. These observations could indicate that ADSCs at later passages are better suited for differentiation. However, the haematopoietic marker CD45 also became apparent at later passages. Because flow cytometry revealed that a large portion of the cells in these passages were positive for both mesenchymal and haematopoietic cell markers, this suggests that the ADSCs at these higher passages express both cell surface markers simultaneously. These results indicate that ADSCs cultured for long periods are not identical to those at early passages. They also imply that expression of mesenchymal cell markers is not necessarily an indication of identical cell populations or the differentiation potential of multipotent adult stem cells.

In this study, we found that serum removal and treatment with the PKC activator, PMA, increased the expression of several cardiac mRNAs in ADSCs. These cells showed some deviations in the basal mRNA levels for several cardiac genes, notably cardiac actin and Mef2C. Despite these deviations, serum removal followed by activation of PKC by PMA resulted in significant increases in the mRNA levels of several cardiac genes. The response to serum removal and PMA were consistently seen in both preparations of ADSCs at various passages. Furthermore, the expression of cardiac actin and troponin was observed in a large portion of the cell population. Thus, mesenchymal marker-positive ADSCs that are derived from different sources and can be expanded in culture are capable of responding to PKC activation in serum-free medium by increased expression of several cardiomyogenic genes.

This study indicates that human ADSCs can be stably expanded in culture and retain some differentiation potential towards the cardiomyogenic lineage. However, failure to develop fully differentiated cardiomyocyte-like cells highlights the limitation of using these cells for cell-based therapy in patients with cardiac diseases at the present time. Novel approaches using these cells, such as production of iPS (inducible pluripotent stem) cells and other engineering manipulations may unfold the true potential of ADSCs. In addition, future study into the conditions necessary to optimize the differentiation of ADSCs into cardiomyocytes may unlock the therapeutic potential of ADSCs in regenerative medicine.

Author contribution

Eulsoon Park performed research and analysed data and wrote the paper. Amit Patel designed the research and reviewed the paper. The authors declare no conflict of interest.

Acknowledgements

We thank Dr Koichi Takimoto at the Department of Environmental and Occupational Health at the University of Pittsburgh for guidance and review of this study.

Funding

This work was supported by the National Institutes of Health.

REFERENCES

Arai, K, Tsuruta, L, Watanabe, S and Arai, N (1997) Cytokine signal networks and a new era in biomedical research. Mol Cells 7, 1-12
Medline   1st Citation  

Bieback, K, Kern, S, Klüter, H and Eichler, H (2004) Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood. Stem Cells 22, 625-34
Crossref   Medline   1st Citation  

Gimble, JM, Katz, AJ and Bunnell, BA (2007) Adipose-derived stem cells for regenerative medicine. Circ Res 100, 1249-60
Crossref   Medline   1st Citation   2nd   3rd  

Katz, AJ, Tholpady, A, Tholpady, SS, Shang, H and Oqle, AB (2005) Cell surface and transcriptional characterization of human adipose-derived adherent stromal (hADAS) cells. Stem Cells 23, 412-23
Crossref   Medline   1st Citation   2nd  

Lee, WC, Sepulveda, JL, Rubin, JP and Marra, KG (2009) Cardiomyogenic differentiation potential of human adipose precursor cells. Int J Cardiol 133, 399-401
Crossref   Medline   1st Citation   2nd  

Pal, R and Khanna, A (2007) Similar pattern in cardiac differentiation of human embryonic stem cell lines, BG01V and ReliCellhES1, under low serum concentration supplemented with bone morphogenetic protein-2. Differentiation 75, 112-22
Crossref   Medline   1st Citation  

Passier, R, Oostwaard, DW, Snapper, J, Kloots, J, Hassink, RJ, Kuijk, E, Roelen, B, de la Riviere, AB and Mummery, C (2005) Increased cardiomyocyte differentiation from human embryonic stem cells in serum-free cultures. Stem Cells 23, 772-80
Crossref   Medline   1st Citation  

Prockop, DJ, Sekiya, I and Colter, DC (2001) Isolation and characterization of rapidly self-renewing stem cells from cultures of human marrow stromal cells. Cytotherapy 3, 393-6
Crossref   Medline   1st Citation  

Rodríguez, LV, Alfonso, Z, Zhang, R, Leung, J, Wu, B and Ignarro, LJ (2006) Clonogenic multipotent stem cells in human adipose tissue differentiate into functional smooth muscle cells. Proc Natl Acad Sci USA 103, 12167-72
Crossref   Medline   1st Citation  

Romanov, YA, Svintsitskaya, VA and Smirnov, VN (2003) Searching for alternative sources of postnatal human mesenchymal stem cells: candidate MSC-like cells from umbilical cord. Stem Cells 21, 105-10
Crossref   Medline   1st Citation  

Rydén, M, Dicker, A, Götherström, C, Aström, G, Tammik, C, Arner, P and Le Blanc, K (2003) Functional characterization of human mesenchymal stem cell-derived adipocytes. Biochem Biophys Res Commun 311, 391-7
Crossref   Medline   1st Citation  

Strem, BM, Hicok, KC, Zhu, M, Wulur, I, Alfonso, Z, Schreiber, RE, Fraser, JK and Hedrick, MH (2005) Multipotential differentiation of adipose tissue-derived stem cells. Keio J Med 54, 132-41
Crossref   Medline   1st Citation  

Ulloa-Montoya, F, Kidder, BL, Pauwelyn, KA, Chase, LG, Luttun, A, Crabbe, A, Geraerts, M, Sharov, AA, Piao, Y and Ko, MS (2007) Comparative transcriptome analysis of embryonic and adult stem cells with extended and limited differentiation capacity. Genome Biol 8, R163
Crossref   Medline   1st Citation  

van Dijk, A, Niessen, HW, Zandieh, DB, Visser, FC and van Milligen, FJ (2008) Differentiation of human adipose-derived stem cells towards cardiomyocytes is facilitated by laminin. Cell Tissue Res 334, 457-67
Crossref   Medline   1st Citation  

Zuk, PA, Zhu, M, Ashjian, P, De Ugarte, DA, Huang, JI, Mizuno, H, Alfonso, ZC, Fraser, JK, Benhaim, P and Hedrick, MH (2002) Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell 13, 4279-95
Crossref   Medline   1st Citation  


Received 21 February 2010/15 April 2010; accepted 6 May 2010

Published as Cell Biology International Immediate Publication 6 May 2010, doi:10.1042/CBI20100124


© The Author(s) Journal compilation © 2010 Portland Press Limited


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)