| Cancer | ![]() |
Cell death | ![]() |
Cell cycle | ![]() |
Cytoskeleton | ![]() |
Exo/endocytosis | ![]() |
Differentiation | ![]() |
Division | ![]() |
Organelles | ![]() |
Signalling | ![]() |
Stem cells | ![]() |
Trafficking |
|
|
Cell Biology International (2011) 35, 8791 (Printed in Great Britain)
Differentiation of temporomandibular joint synovial mesenchymal stem cells into neuronal cells in vitro: an in vitro study
Zhiming Liu, Xing Long1, Jian Li, Lili Wei, Zhongcheng Gong and Wei Fang
Department of Oral and Maxillofacial Surgery, The State Key Laboratory Breeding Base of Basic Science of Stomatology HubeiMost and Key Laboratory of Oral Biomedicine, Ministry of Education, School and Hospital of Stomatology, Wuhan University, Wuhan, Hubei 430079, Peoples Republic of China
SMSCs (synovial mesenchymal stem cells) isolated from TMJs (temporomandibular joints) were induced to proliferate and differentiate in vitro by bFGF (basic fibroblast growth factor) and explore the potential of SMSC differentiation into neuronal cells. In this study, the cultured SMSCs were derived from the TMJ synovial membrane of condylar hyperplasia patients and were amplified with the indicated concentration of FCS (fetal calf serum) and DMEM (Dulbecco's modified Eagle's medium) in vitro. bFGF (25 ng/ml) was applied to induced synovial cells differentiated into neuronal cells. Inverted microscopy, scanning electron microscopy, immunocytochemical and RT-PCR were used for checking the change of the induced cells. Morphology was mostly spindle; a small part was of a polygon. The undifferentiated SMSCs showed the fibroblast-like morphology; however, most of the differentiated cells were in the shape of a spindle and the rest were polygonal. Furthermore, being induced by bFGF, SMSCs can be found to be a unique long extension from the cell body under the scanning electron microscope. RT-PCR and immunocytochemical analysis was made to confirm nestin (neural stem cell marker) and NF-L (neurofilament-light or neurofilament 68-kDa mature nerve cell marker) expression in SMSCs. SMSCs can differentiate into neuronal cells when induced by bFGF. The bFGF-induced SMSCs not only changed into neural-like cells but also expressed specific markers. Key words: basic fibroblast growth factor, mensenchymal stem cells, neural differentiation, synovial membrane Abbreviations: bFGF, basic fibroblast growth factor, DMEM, Dulbecco's modified eagle's medium, FCS, fetal calf serum, SM, synovial membrane, SMSCs, synovial mesenchymal stem cells, TMJ, temporomandibular joints 1To whom correspondence should be addressed (email longxing_china@hotmail.com). 1. Introduction Adult stem cells can differentiate into various types of cells. For instance, mesenchymal stem cells can differentiate into chondrogenic, osteogenic, neurogenic, myogenic and vascular or blood cells. Skin stem cells can differentiate into neurons, adipose cells or muscle cells (Park et al., 2007). Kawasaki et al. (2000) and Morikawa et al. (2009) suggested the ability of tissue-derived stem cells to differentiate into other stem cells. Some researches show that neural stem cells to derive from more primitive cells that have the capacity to generate neural stem cells and stem cells of other tissues (Gage, 2000). SM (synovial membrane) is loose fibrous connective tissue in temporomandibular joints. The synovial membrane consists of two layers. The first layer is synovial intima, and the second layer is subsynovial tissue. The subintimal tissue contains fibroblasts, macrophages and mast cells and richly supplied with blood vessels and lymphatics and the nerve fibres being those on the adventitia of the blood vessels (Dijkgraaf et al., 1996). Some researchers found that SM-derived cells were induced to differentiate into the chondrocyte, osteocyte, myocyte and adipocyte lineages (De Bari et al., 2001; Kurth et al., 2007; Fan et al., 2009). In our group, SMSCs were differentiated and proliferated as previously described, such as differentiation into chondrocytes and osteocytes (Li et al., 2005). However, there are no papers reporting neurogenesis of SMSCs. The major aim of this study was to investigate the ability of SMSCs to differentiate into neuronal cells using bFGF as a physiological inducer in vitro and study the pain of temporomandibular joint disorders in the future. 2. Materials and methods 2.1. Tissue preparation and culture of SMSCs The synovial membranes were taken from patients having condyle hypertrophy with informed consent and with the permission from the School of Stomatology of Wuhan University Ethical Commission. Initially, the synovial membrane was coarsely minced with a scalpel. Afterwards, it was quickly transferred into tubes which contained sterilized PBS, flushed three times with 100 units/ml penicillin and 100 μg/ml streptomycin (Hyclone Co.). The tissue was sliced into 1-mm3 pieces and kept at intervals of 5 mm3 in 25 ml flasks in DMEM (Dulbecco's modified Eagle's medium)-H (Sigma) culture medium at 37°C, in a humidified atmosphere containing 5% CO2. After 48 h, non-adherent tissues were removed. Fresh DMEM-H and FCS (fetal calf serum; Hyclone Co.) were replaced every 3–4 days until SMSCs were near confluent. The cells were harvested and digested with 0.25% trypsin (Hyclone Co.) and diluted 1:2 or 1:3 for futher expansion. Cells were used after third passages. SMSCs were identified as previously described (Li et al., 2005). 2.2. Neural induction protocol Cells washed three time in PBS were divided into two groups: bFGF (Peprotech Co.)-induced group and negative control group. In the bFGF-induced group, cells were cultured in six-well plates for 7 days in the amplification medium, DMEM/F12 (3:1; Hyclone Co.), 25 ng/ml bFGF, 50 units/ml penicillin/streptomycin and 10% FCS. Furthermore, cells were retrieved from adherent culture by trypsin, counted and plated to a density of 3000 cells/cm2 on poly(lysine)-coated plates. Plates were previously coated overnight with a 10-μg/ml poly(lysine) solution in PBS. However, in the negative control group, the cells were maintained without any bFGF induction medium. The medium was changed every 48 h. 2.3. Immunocytochemical Both the groups were fixed in 95% ethanol for 40 min at room temperature and were incubated overnight. Primary antibody mouse anti-nestin (dilution 1:250; Santa Cruz) and mouse anti-NF-L (dilution 1:500; Santa Cruz) were used at 4°C, and then incubated for 15 min with secondary antibody (goat anti-mouse; Zymed) at 37°C. Nestin (marker of neural stem cells at early stage of differentiation) and NF-L (marker of mature nerve cells) were used as primary antibodies. The experiment was repeated at least three times. 2.4. RNA extraction and analysis Total RNA of the cells was extracted by Trizol (Invitrogen) for RT-PCR (TOYOBO Co.). Primer sequences were as follows: NF-L (GenBank accession number NM_006158) (forward AGTGAAATGGCACGATAC, reverse GTAGTAGGACGGGAAGGA, fragment size 243 base pairs, renaturation at 52°C); nestin (GenBank accession number NM_006617.1) (forward GTGGCTCCAAGACTTCC, reverse CACAGGTGTCTCAAGGGTA, fragment size 152 base pairs, renaturation at 54°C). β-Actin was used as an internal reference in each reaction (forward TGTGCCCATCTACGAGGGGTATGC, reverse GGTACATGGTGGTGCCGCCAGACA, fragment size 433 base pairs, renaturation at 60°C). All primers were selected in different exons. 2.5. Statistical analysis Data were then exported to Microsoft Excel or SPSS 13.0 for Windows software for statistical analysis. All results are presented as mean±S.D. The Student' t test was performed as appropriate. P<0.05 was considered as significantly different. Each experiment was repeated three times. 3. Result and discussion 3.1. SMSC culture Synovial membrane was sliced into pieces and cultured in DMEM-H. Three to five days later, the cells grew as a single layer. When the cells reached confluence, they almost resembled spindle-shaped cells. Primary culture lasted 10–14 days. Recently, many researchers have been using MSCs (mesenchymal stem cells) to induce neural-like cells or neuroglial cells, which proved the potential of MSCs to differentiate into neural stem cells (Bossolasco et al., 2005; Lei et al., 2007). 3.2. SMSCs acquire a neuron-like shape in the presence of bFGF and poly(lysine) bFGF was added to the culture medium of SMSCs, and the cells were plated on poly(lysine)-coated plates. Thus, some short neurite-like extensions were recognized and fully developed after 7 days in the bFGF-induced group (Figure 1). For a long time, bFGF was considered as an important regulating factor in neuron proliferation and differentiation (Palmer et al., 1999). bFGF and EGF (epidermal growth factor) can induce nestin-positive cells from different regions of the human embryo nervous system for 6 to 14 weeks (Daadi et al., 2008). While previous studies demonstrate that bFGF, which can induce fibroblast proliferation, is an indispensable growth factor in proliferation of neural stem cells, the effect of bFGF can be enhanced by LIF) (Palmer et al., 1999; Vaccarino et al., 1999; Techawattanawisal et al., 2007). Recently, bFGF has been used to induce multipotent stem cells into neural stem cells by some investigators (Woodbury et al., 2002; Jin et al., 2003; Sotiropoulou et al., 2006). Synovial cells taken from patients with condyle hypertrophy compared with other-derived MSCs (Sakaguchi et al., 2005) indicate the superiority of SMSCs as a potential source of MSCs for clinical applications. 3.3. Immunocytochemical analysis of cell marker expression After being induced by bFGF for 7 days, cells showed morphological changes and were positive for nestin and NF-L, respectively (Figure 2). In the negative control group, the immunocytochemical results demonstrated that SMSCs were negative for nestin and NF-L expression (Figure 2). A specific marker of neural progenitors is nestin, which is an intermediate filament protein, used to define neural stem cells (Michalczyk and Ziman, 2005; Guerette et al., 2007). NF-L was found specifically in neurons, and the presence of this protein is widely used to define mature nerve cells (Reali et al., 2006). Immunohistochemistry and RT-PCR were used to detect the expression of nestin and NF-L in cytoplasm. 3.4. Morphology by electron microscope and morphological differentiation of SMSCs Some short neurite-like and multipolar neuron-like extensions were visible after being induced 7 days later in the experimental group (Figure 3). 3.5. Results of RT-PCR The result of RT-PCR showed that the expression of nestin and NF-L was confirmed in the experimental group after being induced 7 days later (Figure 4). 4. Conclusion bFGF can induce SMSC proliferation and differentiation into neuronal cells, while controls remained fibroblast-like. Author contribution Zhiming Liu collected and assembled data, and wrote the manuscript. Xing Long was involved in conception and design, financial and administrative support and final approval of the manuscript. Jian Li was involved in conception and design. Lili Wei analysed and interpreted data. Zhongcheng Gong analysed and interpreted data. Wei Fang analysed and interpreted data. Funding This research was supported by grant no. REFERENCES Bossolasco, P, Cova, L, Calzarossa, C, Rimoldi, SG, Borsotti, C and Deliliers, GL (2005) Neuro-glial differentiation of human bone marrow stem cells in vitro. Exp Neurol 193, 312-25 Daadi, MM, Maag, AL and Steinberg, GK (2008) Adherent self-renewable human embryonic stem cell-derived neural stem cell line: functional engraftment in experimental stroke model. PLoS One 3, e1644 De Bari, C, Dell'Accio, F, Tylzanowski, P and Luyten, FP (2001) Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheum 44, 1928-42 Dijkgraaf, LC, de Bont, LG, Boering, G and Liem, RS (1996) Structure of the normal synovial membrane of the temporomandibular joint: a review of the literature. J Oral Maxillofac Surg 54, 332-8 Fan, J, Varshney, RR, Ren, L, Cai, D and Wang, DA (2009) Synovium-derived mesenchymal stem cells: a new cell source for musculoskeletal regeneration. Tissue Eng Part B Rev 15, 75-86 Gage, FH (2000) Mammalian neural stem cells. Science 287, 1433-8 Guerette, D, Khan, PA, Savard, PE and Vincent, M (2007) Molecular evolution of type VI intermediate filament proteins. BMC Evol Biol 7, 164 Jin, K, Mao, XO, Batteur, S, Sun, Y and Greenberg, DA (2003) Induction of neuronal markers in bone marrow cells: differential effects of growth factors and patterns of intracellular expression. Exp Neurol 184, 78-89 Kawasaki, H, Mizuseki, K, Nishikawa, S, Kaneko, S, Kuwana, Y and Nakanishi, S (2000) Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity. Neuron 28, 31-40 Kurth, T, Hedbom, E, Shintani, N, Sugimoto, M, Chen, FH and Haspl, M (2007) Chondrogenic potential of human synovial mesenchymal stem cells in alginate. Osteoarthritis Cartilage 15, 1178-89 Lei, Z, Yongda, L, Jun, M, Yingyu, S, Shaoju, Z and Xinwen, Z (2007) Culture and neural differentiation of rat bone marrow mesenchymal stem cells in vitro. Cell Biol Int 31, 916-23 Li, J, Long, X, Ke, J, Meng, QG and Fang, W (2005) Identification and characterization of synovial mesenchymal stem cells in temporomandibular joint. Zhonghua Kou Qiang Yi Xue Za Zhi 40, 362-4 Michalczyk, K and Ziman, M (2005) Nestin structure and predicted function in cellular cytoskeletal organisation. Histol Histopathol 20, 665-71 Morikawa, S, Mabuchi, Y, Niibe, K, Suzuki, S, Nagoshi, N and Sunabori, T (2009) Development of mesenchymal stem cells partially originate from the neural crest. Biochem Biophys Res Commun 379, 1114-9 Palmer, TD, Markakis, EA, Willhoite, AR, Safar, F and Gage, FH (1999) Fibroblast growth factor-2 activates a latent neurogenic program in neural stem cells from diverse regions of the adult CNS. J Neurosci 19, 8487-97 Park, JS, Kim, S, Han, DK, Lee, JY and Ghil, SH (2007) Isolation of neural precursor cells from skeletal muscle tissues and their differentiation into neuron-like cells. Exp Mol Med 39, 483-90 Reali, C, Scintu, F, Pillai, R, Cabras, S, Argiolu, F and Ristaldi, MS (2006) Differentiation of human adult CD34+ stem cells into cells with a neural phenotype: role of astrocytes. Exp Neurol 197, 399-406 Sakaguchi, Y, Sekiya, I, Yagishita, K and Muneta, T (2005) Comparison of human stem cells derived from various mesenchymal tissues: superiority of synovium as a cell source. Arthritis Rheum 52, 2521-9 Sotiropoulou, PA, Perez, SA, Salagianni, M, Baxevanis, CN and Papamichail, M (2006) Characterization of the optimal culture conditions for clinical scale production of human mesenchymal stem cells. Stem Cells 24, 462-71 Techawattanawisal, W, Nakahama, K, Komaki, M, Abe, M, Takagi, Y and Morita, I (2007) Isolation of multipotent stem cells from adult rat periodontal ligament by neurosphere-forming culture system. Biochem Biophys Res Commun 357, 917-23 Vaccarino, FM, Schwartz, ML, Raballo, R, Nilsen, J, Rhee, J and Zhou, M (1999) Changes in cerebral cortex size are governed by fibroblast growth factor during embryogenesis. Nat Neurosci 2, 848 Woodbury, D, Reynolds, K and Black, IB (2002) Adult bone marrow stromal stem cells express germline, ectodermal, endodermal, and mesodermal genes prior to neurogenesis. J Neurosci Res 69, 908-17 Received 8 March 2010/6 May 2010; accepted 14 October 2010 Published as Cell Biology International Immediate Publication 14 October 2010, doi:10.1042/CBI20100144 © The Author(s) Journal compilation © 2011 Portland Press Limited |
ISSN Print: 1065-6995
ISSN Electronic: 1095-8355 Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB) |