Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2011) 35, 483–490 (Printed in Great Britain)
Insulin-producing cells from human pancreatic islet-derived progenitor cells following transplantation in mice
Ying Zhang*, Zhenhua Ren*, Chunlin Zou*, Shuyan Wang*, Bin Luo†, Fei Li†, Shuang Liu† and Yu Alex Zhang*1
*Department of Cell Therapy Center, Xuanwu Hospital, Capital Medical University, Beijing 100053, Peoples Republic of China, and †Department of General Surgery, Xuanwu Hospital, Capital Medical University, Beijing 100053, Peoples Republic of China


Stem/progenitor cells hold promise for alleviating/curing type 1 diabetes due to the capacity to differentiate into functional insulin-producing cells. The current study aims to assess the differentiation potential of human pancreatic IPCs (islet-derived progenitor cells). IPCs were derived from four human donors and subjected to more than 2000-fold expansion before turning into ICCs (islet-like cell clusters). The ICCs expressed ISL-1 Glut2, PDX-1, ngn3, insulin, glucagon and somatostatin at the mRNA level and stained positive for insulin and glucagon by immunofluorescence. Following glucose challenge in vitro, C-peptide was detected in the sonicated ICCs, instead of in the conditioned medium. To examine the function of the cells in vivo, IPCs or ICCs were transplanted under the renal capsule of immunodeficient mice. One month later, 19 of 28 mice transplanted with ICCs and 4 of 14 mice with IPCs produced human C-peptide detectable in blood, indicating that the in vivo environment further facilitated the maturation of ICCs. However, among the hormone-positive mice, only 9 of 19 mice with ICCs and two of four mice with IPCs were able to secrete C-peptide in response to glucose.


Key words: differentiation, ex vivo, islet-like cell clusters (ICCs), pancreatic islet-derived progenitor cells (IPCs)

Abbreviations: DTZ, dithizone, EGFR, receptor of epithelial growth factor, ES, embryonic stem, FBS, fetal bovine serum, GAPDH, glyceraldehyde-3-phosphate dehydrogenase, GLP-1R, receptor of glucagon-like peptide-1, ICCs, islet-like cell clusters, IPCs, islet-derived progenitor cells, RT, real time

1To whom correspondence should be addressed (email yaz@bjsap.org).


1. Introduction

Pancreatic islet transplantation offers a viable approach to restore physiological secretion of insulin for diabetic patients (Shapiro et al., 2000, 2006). However, this approach is significantly limited by the shortage of human islets. For this reason, it is of great interest to produce functional islet cells from various stem/progenitor cells. Although ES (embryonic stem) cells are a promising source of insulin-secreting cells (Lumelsky et al., 2001; D'Amour et al., 2006; Kroon et al., 2008), several obstacles that include low differentiation efficiency and teratoma formation (Hardy et al., 1990) need to be overcome before human ES cells can be used on human subjects.

Several studies have reported that progenitors reside within the pancreas including the pancreatic ductal epithelium (Rosenberg, 1995; Bonner-Weir et al., 2000; Gmyr et al., 2000; Bodnar et al., 2006), acinar tissue (Rooman et al., 2002; Baeyens et al., 2005; Minami et al., 2008), β-cells (Dor et al., 2004) and mesenchyme (Zulewski et al., 2001; Huang and Tang, 2003; Wu et al., 2004; Lechner et al., 2005). Previous study from our laboratory (Zou et al., 2006) indicates that the pancreatic IPCs (islet-derived progenitor cells) exist in the pancreas from both normal and STZ (streptozotocin)-induced diabetic cynomolgus monkeys. Unlike any of the other known cell types in pancreatic islets, the nestin-positive pancreatic progenitor cells can proliferate and differentiate into β-cell-like cells that are capable of secreting insulin in response to glucose challenge in vitro.

Recently, several groups have been debating upon the differentiation capacity of human IPCs (Ouziel-Yahalom et al., 2006; Davani et al., 2007; Gallo et al., 2007; Kayali et al., 2007; Hanley et al., 2008). In this study, we performed an ex vivo differentiation assay to address this question.

2. Materials and methods

2.1. Cell culture

Human pancreatic islets were obtained from surgically removed specimens. A small piece of pancreas (∼1 g) was acquired from a hemipancreatectomy sample. The pancreatic tissue fragment was chopped and digested with collagenase type V (Sigma–Aldrich) at 1 mg/ml at 37°C. The digestion was stopped, and the islets were purified by discontinued Ficoll gradient centrifugation. The informed consents have been obtained from the patients and all protocols approved by the Institutional Review Board (IRB) of Xuanwu Hospital of the Capital Medical University.

The purified pancreatic islet cells were plated into bacterial-grade Petri dishes for 3∼4 days in RPMI 1640 containing 10% FBS (fetal bovine serum) to remove the adherent fibroblasts. The floating islet cells were then transferred into normal culture dishes in RPMI 1640 medium supplemented with 10% FBS, 20 ng/ml bFGF (basic fibroblast growth factor) and 20 ng/ml EGF (epidermal growth factor) (both from R&D systems). Cells were passaged at 1:3 ratio every 3∼4 days upon 80∼90% confluency.

2.2. In vitro differentiation of IPCs

Cell differentiation was carried out as described previously (Zou et al., 2006) with minor modification. Briefly, the IPCs that had been expanded over 2000-fold (37) were detached with 0.25% trypsin-EDTA, then seeded at 5.5×104cells/cm2 to poly-l-ornithine-coated dishes in serum-free DMEM (Dulbecco's modified Eagle's medium)/F12 (5.6 mM glucose) medium supplemented with 20 ng/ml bFGF, 20 ng/ml EGF, B27 (Invitrogen), 0.05% BSA, 1 mM sodium pyruvate, 2 mM l-glutamine, 100 units/ml penicillin and 100 mg/ml streptomycin. ICCs (islet-like cell clusters) spontaneously formed in 24–48 h. After primary induction, ICCs were transferred into serum-free DMEM/F12 (17.5 mM glucose) medium containing inductive factors [10 mM nicotinamide (Sigma), 500 pM β-cellulin (R&D), 2 nM activin-A (R&D), 10 nM exendin-4 (Sigma) and 10 ng/ml HGF (hepatocyte growth factor) (R&D)], as well as sodium pyruvate, B-27, 0.05% BSA, l-glutamine, penicillin and streptomycin. After 4–6 days of induction, ICCs were collected and used for further analysis. For each differentiation assay, the ICCs from three separate wells were harvested and analysed independently.

2.3. Immunofluorescent staining

Monolayer cell cultures were fixed for 20 min in 4% paraformaldehyde prior to staining. In the in vivo experiments, the graft-bearing kidneys were dissected out from killed mice and fixed with 4% paraformaldehyde before being embedded in paraffin. Five-micrometre sections were prepared for staining. The primary antibodies used were nestin (Chemicon), vimentin (Chemicon), GLP-1R (receptor of glucagon-like peptide-1) (Santa Cruz), Glut-2 (Sigma-Aldrich), c-Met (Chemicon), EGFR (receptor of epithelial growth factor) (Santa Cruz), ISL-1 (Chemicon), CK19 (Zymed), glucagon (Sigma–Aldrich), somatostatin (DAKO), and insulin (Zymed). The secondary antibodies used were Texas red-conjugated donkey anti-guinea pig IgG, Texas red-conjugated goat anti-mouse IgG, Texas red-conjugated goat anti-rabbit IgG, Texas red-conjugated goat anti-mouse IgG and Cy2-conjugated goat anti-mouse IgG, (1:200; Jackson ImmunoResearch). Fluorescent images were captured using a Leica DM4000 microscope and SPOT RT camera. The final images were rendered by Adobe Photoshop.

2.4. RT (real time)-PCR and quantitative RT-PCR

Total RNA was extracted from IPCs or ICCs by using RNeasy Mini Kit (QIAGEN) according to the manufacturer's instructions. First-strand cDNA was synthesized from 2 μg of RNA in a 25-μl reaction volume using Superscript II system (Invitrogen). PCR was performed on a PTC-100 thermal cycler (Bio-Rad Laboratories, Inc.) using rTaq polymerase (Takara, Bio, Inc.) in a total volume of 25 μl containing 1 μl of cDNA. Quantitative RT-PCR was performed using the DNA Engine Opticon 2 RT-PCR (MJ Research) system. For each cell type and preparation, the mRNA level of the associated gene was normalized to the level of GAPDH (glyceraldehyde-3-phosphate dehydrogenase). Primer sequences employed here were listed (Table 1).


Table 1 Sequences of PCR primers and expected product size of the target genes

Gene Sense primer Antisense primer Product size (bp)
For RT-PCR
    β-actin TGGCACCACACCTTCTACAATGAGC GCACAGCTTCTCCTTAATGTCACGC 396
    Nestin AGAGGGGAATTCCTGGAG CTGAGGACCAGGACTCTCTA 495
    GLP-1R TCTCTGCTCTGGTTATCGCCTC AGATAAGACCGAGAAGGCCAGC 317
    Isl-1 TGTTTGAAATGTGCGGAGTG GTTCTTGCTGAAGCCGATG 144
    ABCG2 GGCCTCAGGAAGACTTATGT AAGGAGGTGGTGTAGCTGAT 342
    Glut-2 TTGCTGGAAGAAGCATATCAGG TGACTAATAAGAATGCCCGTGAC 148
    PDX-1 TGATACTGGATTGGCGTTGT GCATCAATTTCACGGGATCT 270
    ngn3 TACAAGCTGTGGTCCGCTATG GGAGTCGGCGAAAGAAGGC 197
    Insulin GCCTTTGTGAACCAACACCTG GTTGCAGTAGTTCTCCAGCTG 268
    Glucagon ATTCACAGGGCACATTCACC AACAATGGCGACCTCTTCTG 260
    Somatostatin GCTGCTGTCTGAACCCAAC CGTTCTCGGGGTGCCATAG 138
For real-time PCR
    GAPDH ATGACATCAAGAAGGTGGTG CATACCAGGAAATGAGCTTG 177
    Insulin GCAGCCTTTGTGAACCAACAC CCCCGCACACTAGGTAGAGA 67



2.5. Western blot for islet-specific gene expression

Total protein was extracted from IPCs, ICCs or pancreas tissue, and protein concentration was calculated using the BCA (bicinchoninic acid) assay (Pierce). Protein samples were tested with insulin antibody (Abcam), glucagon antibody (Abcam) and GAPDH antibody (Bethyl Laboratories). Equal amounts of protein were subjected to SDS/PAGE, transferred to PVDF membrane and probed with respective antibodies.

2.6. Differentiation of IPCs into adipocytes, chondrocytes and osteocytes

To induce adipogenesis, chondrogenesis and osteogenesis, IPCs were cultured in the appropriate induction media according to the manufacturer's protocols (Lonza Walkersville, Inc.). The differentiated phenotypes were documented using Oil Red O staining for adipocytes, Safranin O staining for chondrocytes, and von Kossa staining for osteocytes.

2.7. Measurement of insulin and C-peptide of ICCs by glucose challenge

Secretion of the insulin and C-peptide from proinsulin was assayed using a human ultrasensitive insulin or C-peptide ELISA kit (Mercodia). For each assay, ICCs were washed twice with DMEM (without glucose). Two hundred ICCs were handpicked and placed in a microfuge tube containing 250 μl of DMEM (0, 2.8, 17.6 mmol/l glucose) and incubated for 90 min at 37°C. At the end of incubation, the ICCs were spun down and the supernatant collected for measurement of secreted insulin and C-peptide. The pelleted ICCs were sonicated in acid/ethanol at 4°C for measurement of intracellular insulin and C-peptide.

2.8. Transplantation

Male NOD/SCID mice aged 8∼12 weeks were purchased from the Chinese Academy of Medical Sciences for the in vivo study. The recipient mice were transplanted with ICCs (n = 28), IPCs (n = 14) or fresh human islets (200 islets/mouse, n = 2) under the renal capsule. For each mouse in the ICCs group, 1000∼1500 ICCs (50–200 μm, approximately 2×106 cells) were grafted. For the IPCs group, 2×106 monodispersed cells were implanted in each mouse. Sham control group (n = 5) were subjected to surgery without cell transplantation.

At 4 weeks after transplantation, the mice were fasted overnight and then challenged with glucose (2 mg/g body weight through intraperitoneal injection). Blood samples were obtained from tail vein before and 30 min after glucose injection. Blood samples from fresh islet-transplanted mice were collected 4, 7, 21 and 30 days after transplantation. All the serum was stored at −20°C before the human C-peptide levels were assayed.

2.9. Statistical analysis

Statistical differences were calculated by two-tailed Student's t test at P<0.05.

3. Results

3.1. Cell culture

Isolated and purified pancreatic islets were confirmed by DTZ (dithizone) staining (Figure 1A). During the course of cell culture, human islets gradually changed their morphology from the original three-dimensional architecture to the monolayer plaque of stellate-shaped cells. Fibroblast-like cells migrated from the monolayer plaques and grew to confluence by days 14–16, depending on the initial inoculation density of islets. The proliferating cells were split at 1:3 ratio every 2∼3 days for at least eight passages without a change in replication rate or noticeable cell mortality. On average, out of 100 isolated islets, a total of 2–5×1011 cells can be generated. Based on their expansion capacity and differentiation ability, these cells are termed IPCs. No apparent difference was found between the cells obtained from different donors, in terms of the proliferation and differentiation capacity.

To determine whether these IPCs express specific markers of pancreas, we performed RT-PCR and immunocytochemical staining on the IPCs between passages number 4 and 6 (Figures 1B and 2). These cells expressed the neuroepithelial precursor cell marker nestin, mesenchymal stromal cell marker vimentin and the haematopoietic precursor cell marker ATP-binding cassette transporter ABCG2. Receptors of some growth and differentiation factors including c-Met (receptor of hepatocyte growth factor), EGFR and GLP-1R were strongly detected. The characteristic markers of pancreas, insulin, CK19 and PDX-1, were undetectable in the IPCs. IPCs cultured in appropriate differentiation media showed adipogenic, osteogenic or chondrogenic differentiation potential (Figure 1C).

3.2. In vitro differentiation of IPCs

By immunochemical staining, co-expression of pancreatic endocrine markers, insulin and glucagon, was detected in ICCs (Figure 3A). By RT-PCR, the mRNA expression of pancreas differentiation genes (Glut-2, PDX-1 and ngn3), mature pancreas genes (insulin, glucagon and somatostatin), as well as stem cell markers (nestin, ABCG2) were detected in ICCs (Figure 3B). The quantitative RT-PCR was performed to examine the mRNA levels of insulin, PDX-1 and ISL-1 in IPCs and ICCs. The three gene transcripts were almost undetectable in IPCs, whereas the mRNA levels of insulin, PDX-1 and ISL-1 in ICCs were about 474-, 834- and 10-fold higher than in IPCs, respectively, indicating that ICCs had been committed to islet lineage (Figure 3C). Similar changes in the protein level of insulin and glucagon were confirmed by Western blot analysis (Supplementary Figure S1 at http://www.cellbiolint.org/cbi/035/cbi0350483add.htm).

In addition, we incubated the ICCs with no glucose, low glucose (2.8 mmol/l) or high glucose (16.7 mmol/l) to determine if the ICCs were responsive to glucose challenge. No C-peptide secretion was detected in the extracellular supernatant with or without glucose challenge (data not shown). Instead, abundant intracellular C-peptide was detected in the sonicated ICCs following glucose challenge (Figure 3D). Around 2×107 mIU insulin per min per ICC was detected intracellularly and around 3.1×107 and 1×107 mIU insulin per min per ICC detected in the conditioned medium after 2.8 and 16.7 mM glucose challenge, respectively. Little extracellular insulin was detected without glucose challenge (Supplementary Figure S2 at http://www.cellbiolint.org/cbi/035/cbi0350483add.htm).

3.3. In vivo differentiation of ICCs/IPCs

Since we failed to detect any extracellular C-peptide secretion by ICCs in vitro, it was of interest to investigate if the ICCs would differentiate into islets in vivo. The normoglycaemic NOD/SCID mice were transplanted with either IPCs (representing cells at proliferating stage) or ICCs (representing cells committed to a pancreatic lineage in vitro) under the kidney capsule. Four weeks after transplantation, the blood samples of the recipient mice were collected for the measurement of human C-peptide. In ICC graft group, 19 of 28 mice showed detectable levels of human C-peptide (>1∼75 pmol/l) either before or after glucose challenge. Among the 19 human C-peptide positive mice, nine mice up-regulated C-peptide expression in response to glucose challenge (Figure 4A). In the IPC graft group, only 4 of 14 mice produced detectable levels of C-peptide (∼7 pmol/l), and two of the four responded to glucose challenge (Figure 4A). The C-peptide concentrations of IPCs group were mostly lower than those of the ICCs group (Figure 4A). The average serum concentrations of human C-peptide from the ICCs group were 6.6±14.6 pmol/l (fasting; n = 28) and 6.9±14.0 pmol/l (stimulated; n = 28), while the mean values from the IPCs group were 0.6±1.7 (fasting; n = 14) and 1.2 ± 2.4 pmol/l (stimulated; n = 14) (Figure 4B). Another two mice transplanted with fresh human islets were used as positive controls; the mean value of serum concentrations of human C-peptide at post-transplant days 4, 7, 21 and 30 were 28.6, 36.4, 119.0 and 116.1 pmol/l, respectively (Figure 4B).

The pathological analysis using H&E staining revealed cell clusters in the kidney of the recipient mice 4 weeks after transplantation. The cell clusters appeared to be human ICC aggregates and stained positive for insulin by immunohistochemical staining (Figure 4C).

4. Discussion

By an ex vivo differentiation assay, we found that pancreatic IPCs could differentiate into C-peptide-secreting cells, which verified the islet differentiation potential of IPCs and highlighted a supportive in vivo environment that can further facilitate the maturation of ICCs predifferentiated in vitro.

During the course of in vitro differentiation, the ICCs began assuming an aberrant morphology after 5–6 days in culture (data not shown). So we chose day 4 ICCs as donor cells for transplantation. The predifferentiated ICCs expressed mature pancreas genes (ISL-1, Glut2, PDX-1, ngn3, insulin, glucagon and somatostatin) at mRNA level and stained positive for insulin and glucagon by immunofluorescence (Figures 3A, 3B), indicating a commitment to islet lineage. Following glucose challenge in vitro, both C-peptide and insulin were detected in the sonicated ICCs. However, only insulin was found in the conditioned medium (Figure 3D, s1). The reason for the failure to detect C-peptide in the conditioned medium was unknown but may indicate an incomplete functionality of ICCs in vitro in terms of hormone release.

In the in vivo experiments, after IPCs were transplanted into the NOD/SCID mice, little C-peptide was detected in the serum even after glucose challenge (Figure 4A), indicating that IPCs were not able to spontaneously differentiate into β-cells in vivo. In contrast, most mice (68%) from the ICC graft group produced C-peptide, 48% of which up-regulated C-peptide in response to glucose challenge (Figure 4A), suggesting that the ICCs, after transplantation, may have further matured and restored C-peptide release capacity, which was not seen in vitro. The observation that ICCs group included more C-peptide-positive mice and higher C-peptide level than IPCs group may be attributed to a higher level of differentiation state of ICCs prior to transplantation.

Taking the above data into consideration, we suggested that the in vivo environment may have contributed to the survival and further maturation of ICCs. Similar functions of microenvironment as cell fate determinant have been reported for other stem cell types (Bertrand et al., 2000; Lee et al., 2008; Xie et al., 2009).

There is a recent debate upon the differentiation capacity of human pancreatic IPCs. Two published reports differed from our results in some aspects (Davani et al., 2007; Kayali et al., 2007). First, our ICCs were produced in serum-free medium (DMEM/F12, 5.6 mM glucose) containing inductive factors (nicotinamide, β-cellulin, activin-A, exendin-4 and HGF), while their ICCs were both formed in serum-free medium (CMRL-1066), without supplementation of specific factors known to induce pancreatic differentiation. Then, after similar ICC graft transplantation protocol, Davani et al. (2007) showed that between 12 and 24 days after transplantation, human C-peptide was detected in 3 of 34 fasting mice (mean = 0.056 ng/ml) and in 22 of the 34 mice following stimulation with glucose (0.13 ng/ml) (P<0.0001). Kayali and colleagues (2007) showed that no human C-peptide secretion was detected in any of a total 10 mice 2 months after transplantation. In our experiments, we detected human C-peptide in 19 of 28 mice either before or after glucose challenge (>1–75 pmol/l) 4 weeks after transplantation, and nine mice up-regulated C-peptide expression in response to glucose. The mean level of human C-peptide from the nine mice was 3.843 pmol/l ( = 0.012 ng/ml; fasting) and 20.292 pmol/l ( = 0.061 ng/ml; stimulated). We found that the human IPCs appeared to be able to differentiate into hormone-producing cells ex vivo, yet few were able to secrete C-peptide in response to glucose.

In our study, non-diabetic mice were used as recipients for IPCs or ICCs transplantation, in that diabetic environment is not suitable for cell survival (Korsgren et al., 1989; Juang et al., 1994; Makhlouf et al., 2003; Wu et al., 2004), and diabetic mice are in poor health condition, which may affect the data interpretation. We made sure that only human C-peptide, rather than mouse C-peptide, was measured by using a species-specific ELISA kit. However, this does not rule out the possibility that following glucose challenge in vivo, the endogenous β-cells react quickly to the stimulation, whereas the transplanted cells may react in a much less timely and robust manner.

In summary, we confirmed that human pancreatic IPCs possess the islet lineage differentiation potential. However, both the production and the regulation of graft-derived C-peptide were far from satisfactory for a therapy purpose, which warrants the search for a better differentiation protocol that can give rise to a higher yield and more functional islet cells.

Author contribution

Ying Zhang and Yu Alex Zhang were the guarantors of integrity of the entire study. Ying Zhang and Yu Alex Zhang were responsible for the study concepts. Ying Zhang, Chunlin Zou, Yu Alex Zhang were responsible for the study design. Data acquisition was the responsibility of Ying Zhang, Zhenhua Ren, Shuyan Wang, Bin Luo, Shuang Liu and Yu Alex Zhang. Data analysis/interpretation was the responsibility of Ying Zhang and Yu Alex Zhang. Statistical analysis was the responsibility of Ying Zhang and Shuyan Wang. Ying Zhang was involved in the manuscript preparation. Ying Zhang, Bin Luo and Yu Alex Zhang were responsible for manuscript editing. Manuscript revision/review and final version approval were the responsibilities of all authors.

Funding

This work was supported by the National 973 programme [grant number2006CB0F0600], the 863 programme [grant number2006AA02A112] of the People's Republic of China and a core grant from the Beijing Municipal Science and Technology Commission [grant number D07050701350706].

REFERENCES

Baeyens, L, De Breuck, S, Lardon, J, Mfopou, JK, Rooman, I and Bouwens, L (2005) In vitro generation of insulin-producing beta cells from adult exocrine pancreatic cells. Diabetologia 48, 49-57
Crossref   Medline   1st Citation  

Bertrand, FE, Eckfeldt, CE, Fink, JR, Lysholm, AS, Pribyl, JA and Shah, N (2000) Microenvironmental influences on human B-cell development. Immunol Rev 175, 175-86
Crossref   Medline   1st Citation  

Bodnar, CA, Sen, A, Kallos, MS, Behie, LA, Petropavlovskaia, M and Rosenberg, L (2006) Characterization of human islet-like structures generated from pancreatic precursor cells in culture. Biotechnol Bioeng 93, 980-8
Crossref   Medline   1st Citation  

Bonner-Weir, S, Taneja, M, Weir, GC, Tatarkiewicz, K, Song, KH and Sharma, A (2000) In vitro cultivation of human islets from expanded ductal tissue. Proc Natl Acad Sci USA 97, 7999-8004
Crossref   Medline   1st Citation  

D'Amour, KA, Bang, AG, Eliazer, S, Kelly, OG, Agulnick, AD and Smart, NG (2006) Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat Biotechnol 24, 1392-401
Crossref   Medline   1st Citation  

Davani, B, Ikonomou, L, Raaka, BM, Geras-Raaka, E, Morton, RA and Marcus-Samuels, B (2007) Human islet-derived precursor cells are mesenchymal stromal cells that differentiate and mature to hormone-expressing cells in vivo. Stem Cells 25, 3215-22
Crossref   Medline   1st Citation   2nd   3rd  

Dor, Y, Brown, J, Martinez, OI and Melton, DA (2004) Adult pancreatic beta-cells are formed by self-duplication rather than stem-cell differentiation. Nature 429, 41-6
Crossref   Medline   1st Citation  

Gallo, R, Gambelli, F, Gava, B, Sasdelli, F, Tellone, V and Masini, M (2007) Generation and expansion of multipotent mesenchymal progenitor cells from cultured human pancreatic islets. Cell Death Differ 14, 1860-71
Crossref   Medline   1st Citation  

Gmyr, V, Kerr-Conte, J, Belaich, S, Vandewalle, B, Leteurtre, E and Vantyghem, MC (2000) Adult human cytokeratin 19-positive cells reexpress insulin promoter factor 1 in vitro: further evidence for pluripotent pancreatic stem cells in humans. Diabetes 49, 1671-80
Crossref   Medline   1st Citation  

Hanley, SC, Pilotte, A, Massie, B and Rosenberg, L (2008) Cellular origins of adult human islet in vitro dedifferentiation. Lab Invest 88, 761-72
Crossref   Medline   1st Citation  

Hardy, K, Carthew, P, Handyside, AH and Hooper, ML (1990) Extragonadal teratocarcinoma derived from embryonal stem cells in chimaeric mice. J Pathol 160, 71-6
Crossref   Medline   1st Citation  

Huang, H and Tang, X (2003) Phenotypic determination and characterization of nestin-positive precursors derived from human fetal pancreas. Lab Invest 83, 539-47
Medline   1st Citation  

Juang, JH, Bonner-Weir, S, Wu, YJ and Weir, GC (1994) Beneficial influence of glycemic control upon the growth and function of transplanted islets. Diabetes 43, 1334-9
Crossref   Medline   1st Citation  

Kayali, AG, Flores, LE, Lopez, AD, Kutlu, B, Baetge, E and Kitamura, R (2007) Limited capacity of human adult islets expanded in vitro to redifferentiate into insulin-producing beta-cells. Diabetes 56, 703-8
Crossref   Medline   1st Citation   2nd   3rd  

Korsgren, O, Jansson, L and Andersson, A (1989) Effects of hyperglycemia on function of isolated mouse pancreatic islets transplanted under kidney capsule. Diabetes 38, 510-5
Crossref   Medline   1st Citation  

Kroon, E, Martinson, LA, Kadoya, K, Bang, AG, Kelly, OG and Eliazer, S (2008) Pancreatic endoderm derived from human embryonic stem cells generates glucose-responsive insulin-secreting cells in vivo. Nat Biotechnol 26, 443-52
Crossref   Medline   1st Citation  

Lechner, A, Nolan, AL, Blacken, RA and Habener, JF (2005) Redifferentiation of insulin-secreting cells after in vitro expansion of adult human pancreatic islet tissue. Biochem Biophys Res Commun 327, 581-8
Crossref   Medline   1st Citation  

Lee, J, Han, DJ and Kim, SC (2008) In vitro differentiation of human adipose tissue-derived stem cells into cells with pancreatic phenotype by regenerating pancreas extract. Biochem Biophys Res Commun 375, 547-5
Crossref   Medline   1st Citation  

Lumelsky, N, Blondel, O, Laeng, P, Velasco, I, Ravin, R and McKay, R (2001) Differentiation of embryonic stem cells to insulin-secreting structures similar to pancreatic islets. Science 292, 1389-94
Crossref   Medline   1st Citation  

Makhlouf, L, Duvivier-Kali, VF, Bonner-Weir, S, Dieperink, H, Weir, GC and Sayegh, MH (2003) Importance of hyperglycemia on the primary function of allogeneic islet transplants. Transplantation 76, 657-64
Crossref   Medline   1st Citation  

Minami, K, Okano, H, Okumachi, A and Seino, S (2008) Role of cadherin-mediated cell-cell adhesion in pancreatic exocrine-to-endocrine transdifferentiation. J Biol Chem 283, (20), 13753-61
Medline   1st Citation  

Ouziel-Yahalom, L, Zalzman, M, Anker-Kitai, L, Knoller, S, Bar, Y and Glandt, M (2006) Expansion and redifferentiation of adult human pancreatic islet cells. Biochem Biophys Res Commun 341, 291-8
Crossref   Medline   1st Citation  

Rooman, I, Lardon, J and Bouwens, L (2002) Gastrin stimulates beta-cell neogenesis and increases islet mass from transdifferentiated but not from normal exocrine pancreas tissue. Diabetes 51, 686-90
Crossref   Medline   1st Citation  

Rosenberg, L (1995) In vivo cell transformation: neogenesis of beta cells from pancreatic ductal cells. Cell Transplant 4, 371-83
Crossref   Medline   1st Citation  

Shapiro, AM, Lakey, JR, Ryan, EA, Korbutt, GS, Toth, E and Warnock, GL (2000) Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N Engl J Med 343, 230-8
Crossref   Medline   1st Citation  

Shapiro, AM, Ricordi, C, Hering, BJ, Auchincloss, H, Lindblad, R and Robertson, RP (2006) International trial of the Edmonton protocol for islet transplantation. N Engl J Med 355, 1318-30
Crossref   Medline   1st Citation  

Wu, F, Jagir, M and Powell, JS (2004) Long-term correction of hyperglycemia in diabetic mice after implantation of cultured human cells derived from fetal pancreas. Pancreas 29, e23-9
Crossref   Medline   1st Citation   2nd  

Xie, QP, Huang, H, Xu, B, Dong, X, Gao, SL and Zhang, B (2009) Human bone marrow mesenchymal stem cells differentiate into insulin-producing cells upon microenvironmental manipulation in vitro. Differentiation 77, 483-91
Crossref   Medline   1st Citation  

Zou, C, Suen, PM, Zhang, Y, Wang, Z, Chan, P and Leung, PS (2006) Isolation and in vitro characterization of pancreatic progenitor cells from the islets of diabetic monkey models. Int J Biochem Cell Biol 38, 973-84
Crossref   Medline   1st Citation   2nd  

Zulewski, H, Abraham, EJ, Gerlach, MJ, Daniel, PB, Moritz, W and Müller, B (2001) Multipotential nestin-positive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes 50, 521-33
Crossref   Medline   1st Citation  


Received 5 March 2010/13 October 2010; accepted 16 November 2010

Published as Cell Biology International Immediate Publication 16 November 2010, doi:10.1042/CBI20100152


© The Author(s) Journal compilation © 2011 Portland Press Limited


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)