Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2011) 35, 883–889 (Printed in Great Britain)
Expression of antioxidant defense and poly(ADP-ribose) polymerase-1 in rat developing Sertoli cells
Linda Scarabelli*, Cristina Lanza*, Ilaria Demori*1, Rita Accomando*, Vincenzo Giansanti†, Anna Ivana Scovassi† and Silvio Palmero*
*Dipartimento di Biologia, Universit di Genova, Corso Europa 26, Genova 16132, Italy, and †Istituto di Genetica Molecolare CNR, via Abbiategrasso 207, Pavia 27100, Italy


Sertoli cells play an essential role in the development of a functional testis. ROS (reactive oxygen species) are normally produced by the developing testicular cells and may be dangerous to spermatogenesis. The aim of this study was to investigate the developmental expression of genes involved in antioxidant defense as well as in the DNA damage response in rat Sertoli cells. As revealed by quantitative RT-PCR analysis, the expression pattern of the antioxidant enzymes GST (glutathione-S-transferase), CAT (catalase) and SOD (superoxide dismutase) showed a progressive decrease from birth to puberty. The expression level of the oncosuppressor p53 revealed a net reduction as well. We next focused on PARP-1 [poly(ADP-ribose) polymerase-1], a ‘guardian of the genome’ that combats stress conditions. At both the mRNA and protein level, PARP-1 expression was low at the early stage of development and increased later on. Maximal PARP-1 expression was preceded by a rise in the transcript level for MTs (metallothioneins), which provide zinc to zinc-dependent enzymes and proteins, including PARP-1. Our results showed an increased expression of PARP-1 during Sertoli cell development, together with a decrease in the expression of antioxidant enzymes. In conclusion, a role of PARP-1 in protecting the testicular differentiation is suggested.


Key words: antioxidant enzyme, p53, PARP-1, metallothionein, Sertoli cell

Abbreviations: CAT, catalase, DMEM, Dulbecco's modified Eagle's medium, GAPDH, glyceraldehyde 3-phosphate dehydrogenase, GST, glutathione-S-transferase, MT, metallothionein, PARP-1, poly(ADP-ribose) polymerase-1, ROS, reactive oxygen species, SOD, superoxide dismutase

1To whom correspondence should be addressed (email idemori@unige.it).


1. Introduction

Sertoli cells play essential roles in testis function both in fetal and adult life. During embryonic development, they are of central importance for the early determination of male somatic sex. After birth, immature Sertoli cells continue to divide and differentiate, while their proliferation declines and stops at the onset of puberty. Mature differentiated Sertoli cells are in close contact with germ cells within the seminiferous tubules and fill a crucial nursing function by providing germ cells with nutrients, paracrine and hormonal signals, thus regulating spermatogenesis during adult life (Petersen and Soeder, 2006). The presence of poorly differentiated Sertoli cells in the adult testis is possibly involved in the genesis of testicular diseases such as sterility and cancer (Sharpe et al., 2003). Thus, the study of the mechanisms underlying postnatal differentiation of Sertoli cells is of high interest.

Potentially toxic ROS (reactive oxygen species) are produced during normal cellular metabolism and mainly in the pro-oxidant status, as a result of increased lipid peroxidation; nevertheless, proper production of ROS seems to play a physiological role in cellular differentiation (Sohal et al., 1988). In this respect, a proper endogenous production of ROS has been suggested to be required for normal testis cellular differentiation (Peltola et al., 1992). Therefore, the processes involved in the control of ROS production at the testicular level may imply significant physiological and/or toxicological consequences.

Each testicular cell type is equipped with antioxidant enzymes. In particular, protection against oxidative stress is essential for Sertoli cells considering their strong phagocytic activity, which is always associated with ROS production (Bauché et al., 1994).

Damaging ROS production can be counteracted by antioxidant enzymes such as GST (glutathione-S-transferase), CAT (catalase) and SOD (superoxide dismutase). Moreover, also the ‘guardians’ of the genome p53 and PARP-1 [poly(ADP-ribose) polymerase-1] could be useful to combat the effects of oxidative stress. In fact, poly(ADP-ribosylation) reactions are involved in many physiological and pathophysiological processes and conditions (Hassa et al., 2006; Hassa and Hottiger, 2008), and a physiological role of oxidative stress-induced PARP-1 activation has been demonstrated (Erdélyi et al., 2005).

As for testis metabolism, poly(ADP-ribosylation) reactions have been studied during spermatogenesis (Quesada et al., 1996; Atorino et al., 2000; Di Meglio et al., 2003; Maymon et al., 2006). When dramatic changes in chromatin structure take place, PARP-1 modulates chromatin-remodelling steps during sperm cell maturation (Meyer-Ficca et al., 2005). In mouse Sertoli cell lines treated with an apoptogenic drug, changes in PARP-1 activity and structure have been recently observed (Lee et al., 2009). However, the expression pattern of PARP-1 in the developing Sertoli cells has not been so far elucidated.

In the present work, we studied the expression of antioxidant enzymes, i.e. GST, CAT and SOD, as well as of p53 and PARP-1, during the postnatal differentiation of Sertoli cells isolated from rat testis. Furthermore, taking into account the fundamental role of MTs (metallothioneins) in providing zinc to antioxidant zinc-dependent enzymes and proteins (Kagi and Schaffer, 1988; Thirumoorthy et al., 2007), including PARP-1, we investigated the pattern of MT expression during Sertoli cell development.

2. Materials and methods

2.1. Chemicals

All chemicals, unless otherwise indicated, were of analytical grade and purchased from Sigma–Aldrich.

2.2. Sertoli cells isolation and culture

Animals were obtained from Harlan, Italy, and housed under conditions of controlled temperature and light, according to national guidelines for animal care and use. Additionally, animal ethics approval was obtained from the Italian Ministry of Health.

Sertoli cell cultures were obtained from Wistar pre- and peri-pubertal rats (7-, 14-, 21- and 28-day old), as previously described (Dorrington et al., 1975; Palmero et al., 1988). Briefly, the testicular tissue was minced and sequentially digested with 0.25% (w/v) trypsin, 0.1% (w/v) collagenase and 0.2% (w/v) DNase I. Sertoli cell-enriched aggregates were cultured at 32°C in serum-free DMEM (Dulbecco's modified Eagle's medium) in a water-saturated atmosphere of 95% and 5% CO2. After 24 h, cell monolayers were subjected to hypotonic treatment to remove germ cell contaminants (Galdieri et al., 1981). Sertoli cell preparations were found to be more than 90% pure. The contamination by peritubular cells, as evaluated by cytochemical detection of alkaline phosphatase activity, was about 5%, (Palombi et al., 1988). Cell viability, monitored by Trypan Blue exclusion assay, was greater than 90%.

The 42GPA9 Sertoli cell line was established from mature polyomavirus large T transgenic mice (Bourdon et al., 1998). Cells were maintained in DMEM containing 10% fetal calf serum at 32°C.

2.3. RNA isolation and real-time RT-PCR

Total RNA was isolated by the acid phenol–chloroform procedure (Chomczynski and Sacchi, 1987) using the Trizol reagent according to the manufacturer's instructions. The purity of RNA was checked via absorption spectroscopy by measuring the A260/280 ratio. Only high purity samples (A260/280>1.8) were subjected to further manipulation. The quality of isolated RNA was assessed by electrophoresis on 1.5% formaldehyde–agarose gel to verify the integrity of the 18S and 28S rRNA. First-strand cDNA was synthesized from 1 μg of total RNA using 200 ng of oligo(dT)18-primer (TIB MolBiol), 200 units of RevertAid Hminus M-MuLV reverse transcriptase (Fermentas), 40 units of RNasin and 1 mM dNTPs (deoxyribonucleotide triphosphates) (Promega) in a final volume of 20 μl (Vergani et al., 2007). The reaction was performed in a Master-cycler apparatus (Eppendorf) at 42°C for 1 h after an initial denaturation step at 70°C for 5 min. The expression levels of genes were quantified in 96-well optical reactions by using a Chromo 4TM System real-time PCR apparatus (Bio-Rad). Real-time PCR reactions were performed in quadruplicate in a final volume of 20 μl containing 10 ng of cDNA, 10 μl of iTaq SYBR Green Supermix with ROX (Bio-Rad) and 0.25 μM of each primer pair (TIB MolBiol). The GAPDH (glyceraldehyde 3-phosphate dehydrogenase) mRNA fragment was used as a housekeeping gene to normalize the expression data, as previously described (Grasselli et al., 2008; Lanza et al., 2009). The accession numbers of the genes used in the study and the primer sequences are shown (Table 1). The thermal protocol included an enzymatic activation step at 95°C (3 min) and 40 cycles of 95°C (15 s), 60°C (30 s) and 72°C (20 s). The melting curve of the PCR products (55–94°C) was also recorded to check the reaction specificity. The relative gene expression of target genes in comparison with the GAPDH reference gene was calculated following the comparative CT threshold method (Pfaffl et al., 2002) using the Bio-Rad software tool Genex-Gene Expression MacroTM (Vandesompele et al., 2002). The normalized expression refers to the amount of mRNA (fold induction) with respect to the sample at 28 days taken as 1. Three independent experiments were carried out.


Table 1 Name and accession number of the target genes, listed together with the sequences of the specific primer pairs

Gene Accession number Forward primer (5′–3′) Reverse primer (5′–3′)
CAT NM_009804 CCTGAGAGAGTGGTACATGC CACTGCAAACCCACGAGGG
GAPDH NM_008084 GACCCCTTCATTGACCTCAAC CGCTCCTGGAAGATGGTGATGGG
GST NM_013541 GTGCCCGGCCCAAGAT TTGATGGGACGGTTCACATG
Mn-SOD NM_013671 GGCTCCCGGCACAACACAGCC CCTCGTGGTACTTCTCCTCGGTG
MT1 NM_013602 CTGCTCCACCGGCGG GCCCTGGGCACATTTGG
MT2 NM_008630 TCCTGTGCCACAGATGGATC GTCCGAAGCCTCTTTGCAGA
PARP-1 NM_013063 TGCAGTCACCCATGTTCGATGG AGAGGAGGCTAAAGCCCTTG
p53 NM_030989 GGCTCCTCCCCAACATCTTATC TACCACCACGCTGTGCCGAAAA



2.4. Western blot analysis

Samples of 2.5×106 cells (fresh or stored in liquid nitrogen) were resuspended with 100 μl of denaturing buffer (4 M urea, 4% β-mercaptoethanol, 62.5 mM Tris/HCl, pH 6.8, 10% glycerol and 0.003% Bromophenol Blue). Cells were disrupted by sonication in ice (50 W twice for 20 s). Extracts were then heated for 10 min at 65°C and run on denaturing polyacrylamide gel (7.5%). Protein transfer was performed at 200 mA for 2 h at 4°C and monitored by the membrane staining with Red Ponceau (Sigma–Aldrich). The membrane was saturated with PTN (PBS containing 10% newborn calf serum and 0.1% Tween 20) for 1 h at room temperature and incubated overnight at 4°C with the anti-PARP-1 rabbit polyclonal antibody (215–228, Calbiochem), diluted 1:2000. After five washes in PBS containing 0.1% Tween 20, the membrane was incubated for 30 min with HRP (horseradish peroxidase)-conjugated anti-rabbit IgG diluted 1:10 000 (Santa Cruz Biotechnology), then washed five times in PBS. Visualization of the immunoreactive bands was obtained by a chemoluminescent substrate (Dura Extended from Pierce). Densitometric analysis was performed with the Quantity One® 4.6.3 software. Three independent experiments were carried out.

2.5. Statistics

ANOVA (analysis of variance) and Bonferroni post-hoc test were performed using GraphPad InStat, version 3.05 package (GraphPad Software).

3. Results

3.1. Antioxidant enzyme and p53 expression decrease during Sertoli cell development

We first studied the expression pattern of antioxidant enzymes during Sertoli cell development, which is characterized by endogenous production of ROS. The mRNA levels of GST, CAT and SOD were evaluated by quantitative RT-PCR. Data are expressed as fold induction in Sertoli cells isolated from rats of 7, 14 and 21 days, with respect to the value corresponding to 28-day-old rats. This was taken as 1, considering that this age matches with the onset of rat puberty, leading to adulthood (Sharpe et al., 2003).

As reported, the expression pattern of all the antioxidants enzymes showed high levels in the neonatal period (7 days: GST 5.70±0.08, CAT 3.97±0.40, SOD 2.13±0.40) and decreased in the early postnatal stage (14 days: GST 0.81±0.10, CAT 2.91±0.06, SOD 0.67±0.07) (Figure 1). The tendency to decrease was further observed in samples representative of the prepubertal condition (21 days: GST 0.61±0.10, CAT 2.29±0.07, SOD 0.30±0.10).

The relative mRNA expression of the p53 oncosuppressor gene in Sertoli cells, evaluated in the same cellular samples, is shown (Figure 2). RT-PCR analysis revealed that the p53 transcript levels are high in the neonatal period (7 days: 3.65±0.30) and decrease thereafter (14 days: 1.69±0.10; 21 days: 0.69±0.03).

3.2. PARP-1 expression increases during Sertoli cell development

We next addressed the expression of the enzyme PARP-1, a protein normally activated by oxidative stress. The levels of PARP-1 transcripts measured by quantitative RT-PCR are depicted (Figure 2). During the prepubertal period, the levels of PARP-1 mRNA increased starting from a low basal expression at 7 days (0.36±0.10) and reached a maximum at 21 days (2.46±0.30). To correlate this modulation with protein expression, we performed Western blot analysis. As shown, a band of 113 kDa, corresponding to PARP-1, was visible in Sertoli cell samples (Figure 3a). Its intensity was faint at day 7 and increased later on. The densitometric analysis of band intensity, taking the 28-day sample as 1, revealed that PARP-1 protein increases from 0.192 (7 days) to 0.473 (14 days) and reaches a maximum of 1.056 at 21 days (Figure 3c). The increase in PARP-1 expression observed at the protein and mRNA levels in the developing rat Sertoli cells was consistent with the measurement of specific enzyme activity, as performed by radiometric assay (Cesarone et al., 1990) in intact cell monolayers (data not shown). Moreover, the same expression level in 28-day-old rats was found in the pure 42GPA9 Sertoli cell line (Bourdon et al., 1998), isolated from adult mouse testis (Figure 4).

3.3. MT expression during Sertoli cell development

Given that PARP-1 requires zinc for its activity, we investigated the expression of MT1 and MT2 by quantitative RT-PCR. As shown, although MT2 was expressed at higher levels with respect to MT1, the pattern of modulation during the postnatal development of Sertoli cells was similar for both isoforms (Figure 5). The maximal expression was recorded at 14 days (compare values relative to 7 days: MT1 0.68±0.10, MT2 1.36±0.30; 14 days: MT1 1.63±0.30, MT2 2.3±0.04; 21 days: MT1 0.24±0.10, MT2 0.84±0.08).

4. Discussion

After birth in mammals, the whole testis undergoes extensive morphological, physiological and biochemical changes that take place during sexual maturation. Somatic Sertoli cells play an essential role in the development of a functional testis (Petersen and Soeder, 2006). Immature Sertoli cells continue to divide and differentiate, but as puberty approaches, they lose the proliferative capacity, begin to produce seminiferous fluid and alter their pattern of protein expression, starting to synthesize, for example transferrin and IL (interleukin)-1α (Skinner and Griswold, 1980; Wahab-Wahlgren et al., 2000). Fully differentiated Sertoli cells regulate the flow of nutrients and growth factors to the germ cells, thus becoming essential for a correct spermatogenesis (Griswold, 1998). Therefore, the process leading to Sertoli cell differentiation is of crucial importance for the testis to perform one of its major tasks: the production of haploid germ cells. Several investigations have focused on hormonal and paracrine regulation of the functions of the mature Sertoli cells, but the mechanisms underlying their differentiation remain obscure.

Considering that ROS are normally produced by the developing testicular cells and could be very dangerous to the new forming gametes (Fujii et al., 2003), the present work aimed at investigating the expression of genes involved in antioxidant defence as well as in DNA damage response in Sertoli cells during rat testis ontogenesis. The rat pubertal period ranges from 15 to 30 days of age, so that it overlaps in part with the neonatal period (Sharpe et al., 2003). Anyway, by 28–30 days of life, proliferation ends, and the adult number of Sertoli cells is achieved. Thus, we isolated Sertoli cells from testis of rats at 7, 14, 21 and 28 days of age. From birth to puberty, we found reduced expression levels of the main enzymes in charge of protecting cells from oxidative stress (GST, CAT and SOD). The same trend, i.e. a progressive decrease, was recorded for the expression of p53, a key molecule responsible for halting the cell cycle when DNA is damaged (Liebermann et al., 2007).

Taken together, these findings could suggest a possible decline of ROS levels in the Sertoli cells from birth to puberty. However, other possible explanations ought to be taken into consideration. Actually, the decreased expression of GST, CAT and SOD could also determine the progressive accumulation of ROS. This event could be bypassed by a sustained enzymatic activity of the existing defence enzymes, implying a very long half-life of the relative proteins. It has been reported that GST activity is high in Sertoli cells isolated from 20-day-old rats, compared with the activity measured in other testicular cellular population (Bauché et al., 1994). However, given the long time period required for Sertoli cell development, it appears more likely that other antioxidant activities are involved to counteract ROS accumulation. As an example, Sertoli cells express glutathione reductase and glutathione peroxidase (Bauché et al. 1994), which are physiologically relevant, especially for low micromolar concentrations of hydrogen peroxide (Suttorp et al., 1986; Hiraishi et al., 1991). In addition, it should be considered that the Sertoli cells exhibit a strong phagocytic activity that is always associated with a respiratory burst, implying elevated ROS production (Segal and Abo, 1993; Bauché et al., 1994; Hipler et al., 2000). ROS levels should be finely controlled by homoeostatic mechanisms, not only because they are potentially harmful, but also because of their active role in cell signalling during differentiation and development (Hernandez-Garcia et al., 2010). Bearing all this in mind, we addressed the analysis of another defence enzyme, i.e. PARP-1, the main enzyme responsible for poly (ADP-ribosylation), a post-translational modification involved in a number of basic cell functions (Hakmé et al., 2008; Hassa and Hottiger, 2008). In humans, 18 different genes encode ADP-ribosylating enzymes (Hottiger et al., 2010; Rouleau et al., 2010), among them, PARP-1 is the best-studied and founding member (Schreiber et al., 2006). By using quantitative RT-PCR, Western blot and biochemical assays, we describe here for the first time the modulation of both mRNA and protein PARP-1 levels in rat Sertoli cells, both in the neonatal and peripubertal period of life, when the maturation of this cell type occurs. We found that the mRNA expression level of PARP-1 was low at 7 days of age, increased thereafter and reached the maximum level at 21 days of life, while 28-day-old rat Sertoli cells showed lower stabilized values, possibly typical of the adult cell phenotype. Accordingly, the enzyme activity at the different ages follows the same modulation (data not shown). In addition, the Sertoli cell line 42GPA9, isolated from adult mouse testis, exhibited the same level of PARP-1 expression compared with 28-day-old rat cells. The evidence of PARP-1 expression in the purified 42GPA9 cells suggests the presence of this enzyme in adult Sertoli cells.

On the basis of these data, and of the evidence that both p53 and PARP-1 proteins are considered as ‘guardians of the genome’, it is conceivable that when p53 expression lowers, PARP-1 expression increases, thus suggesting that PARP-1 is possibly in charge of protecting developing Sertoli cells when p53 protein level decreases. Additionally, as Sertoli cell proliferation declines and ceases at the onset of puberty, the decrease of PARP-1 protein expression observed between 21 and 28 days could also be related to a possible role of PARP-1 in the control of Sertoli cell proliferation. Such hypothesis is in line with the previously reported functional correlation between cellular proliferation and PARP-1 activity (Kun et al., 2006).

Moreover, our data obtained from Sertoli cells integrate previous works on the spermatogenic epithelium (Quesada et al., 1996; Atorino et al., 2000; Di Meglio et al., 2003; Maymon et al., 2006) and show converging evidence on a possible protective role of testicular PARP-1, which ultimately impacts the development of sperm.

We then investigated the expression of MTs, which regulate zinc-related cell homoeostasis, zinc metabolism and zinc-dependent protein functions (Kagi and Schaffer, 1988; Thirumoorthy et al., 2007). MTs provide zinc to zinc-dependent enzymes and proteins, including PARP-1, and represent non-catalytic peptides that play an important role in the homoeostasis of essential metals, detoxification of toxic metals and scavenging of oxyradicals (Sigel et al., 2009). MT expression is induced by oxidative stress-producing chemicals as a defense response against their toxicity.

In our experimental conditions, during Sertoli cell postnatal development, the maximal MT expression precedes maximal PARP-1 expression. Therefore, MTs might be included in the antioxidant systems that finely regulate ROS homoeostasis in the developing Sertoli cells. Moreover, our data support the requirement of zinc release by MTs in order to facilitate PARP-1 activity and agree with the idea of a possible interplay between MTs and PARP-1, as reported by Mocchegiani et al. (2003).

4.1. Conclusions

The results of the present study suggest that the mechanisms involved in the control of ROS production are regulated during testicular development, possibly to maintain ROS homoeostasis during cell proliferation and differentiation. Remarkably, we report for the first time the pattern of PARP-1 expression during the postnatal development of rat Sertoli cells and lead to the identification of PARP-1 as a possible marker of differentiation of this cell type. We speculate here that PARP-1 plays an important role in the protection of the differentiation of Sertoli cells, when the antioxidant machinery is less efficient due to a decreased level of proper enzymes.

Author contribution

Linda Scarabelli was responsible for the Sertoli cell isolation and culture, RNA isolation and real-time RT-PCR. Cristina Lanza was in charge of the RNA isolation and real-time RT-PCR, statistics and figure processing. Ilaria Demori was responsible for the Sertoli cell isolation and culture, RNA isolation, manuscript writing and editing. Rita Accomando was in charge of Sertoli cell isolation and culture. Vincenzo Giansanti was responsible for the Western blot analysis. Anna Ivana Scovassi was in charge of the Western blot analysis, manuscript writing and editing. Silvio Palmero was responsible for the research coordination, manuscript writing and editing.

Acknowledgments

We are grateful to Professor E. Fugassa for helpful discussion and to Mrs Alessandra Mancini for reviewing the English text. We especially thank Professor B. Farina for the invaluable help and support during this study. We are indebted to Dr S. Candiani for designing the PARP-1 primers.

Funding

This work was supported by MIUR (Ministero dell'Istruzione, dell'Università e della Ricerca) [grant number PRIN2005]. Vincenzo Giansanti is supported by an Investigator Fellowship from Collegio Ghislieri, Pavia, Italy.

REFERENCES

Atorino, L, Alvarez-Gonzalez, R, Cardone, A, Lepore, I, Farina, B and Quesada, P (2000) Metabolic changes in the poly (ADP-ribosyl) ation pathway of differentiating rat germinal cells. Arch Biochem Biophys 381, 111-8
Crossref   Medline   1st Citation   2nd  

Bauché, F, Fouchard, MH and Jegou, B (1994) Antioxidant system in rat testicular cells. FEBS Lett 349, 392-6
Crossref   Medline   1st Citation   2nd   3rd   4th  

Bourdon, V, Lablak, A, Abbe, P, Segretain, D and Pointis, G (1998) Characterization of a clonal Sertoli cell line using adult PyLT transgenic mice. Biol Reprod 58, 591-9
Crossref   Medline   1st Citation   2nd  

Cesarone, CF, Scarabelli, L, Giannoni, P and Orunesu, M (1990) Differential assay and biological significance of poly(ADP-ribose) polymerase activity in isolated liver nuclei. Mutat Res 245, 157-63
Crossref   Medline   1st Citation  

Chomczynski, P and Sacchi, N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal Biochem 162, 156-9
Medline   1st Citation  

Di Meglio, S, Denegri, M, Vallefuoco, S, Tramontano, F, Scovassi, AI and Quesada, P (2003) Poly (ADPR) polymerase-1 and poly (ADPR) glycohydrolase level and distribution in differentiating rat germinal cells. Mol Cell Biochem 248, 85-91
Crossref   Medline   1st Citation   2nd  

Dorrington, JH, Roller, NF and Fritz, IB (1975) Effects of follicle-stimulating hormone on cultures of Sertoli cell preparations. Mol Cell Endocrinol 3, 57-70
Crossref   Medline   1st Citation  

Erdélyi, K, Bakondi, E, Gergely, P, Szabó, C and Virág, L (2005) Pathophysiologic role of oxidative stress-induced poly(ADP-ribose) polymerase-1 activation: focus on cell death and transcriptional regulation. Cell Mol Life Sci 62, 751-9
Crossref   Medline   1st Citation  

Fujii, J, Iuchi, Y, Matsuki, S and Ishii, T (2003) Cooperative function of antioxidant and redox systems against oxidative stress in male reproductive tissues. Asian J Androl 5, 231-42
Medline   1st Citation  

Galdieri, M, Ziparo, E, Palombi, F, Russo, AM and Stefanini, M (1981) Pure Sertoli cell cultures: a new model for the study of somatic-germ cell interaction. J Androl 2, 249-54
1st Citation  

Grasselli, E, Canesi, L, Voci, A, De Matteis, R, Demori, I, Fugassa, E and Vergani, L (2008) Effects of 3,5-diiodo-l-thyronine administration on the liver of high fat diet-fed rats. Exp Biol Med 233, 549-57
Crossref   1st Citation  

Griswold, MD (1998) The central role of Sertoli cells in spermatogenesis. Semin Cell Dev Biol 9, 411-6
Crossref   Medline   1st Citation  

Hakmé, A, Wong, HK, Dantzer, F and Schreiber, V (2008) The expanding field of poly (ADPribosyl) ation reactions. EMBO Rep 9, 1094-100
Crossref   Medline   1st Citation  

Hassa, PO, Haenni, SS, Elser, M and Hottiger, MO (2006) Nuclear ADP–ribosylation reactions in mammalian cells: where are we today and where are we going? Microbiol Mol Biol Rev 70, 789-829
Crossref   Medline   1st Citation  

Hassa, PO and Hottiger, MO (2008) The diverse biological roles of mammalian PARPS, a small but powerful family of poly-ADP-ribose polymerases. Front Biosci 13, 3046-82
Crossref   Medline   1st Citation   2nd  

Hernandez-Garcia, D, Wood, CD, Castro-Obregon, S and Covarrubias, L (2010) Reactive oxygen species: a radical role in development? Free Rad Biol Med 49, 130-43
Crossref   Medline   1st Citation  

Hipler, UC, Hipler, B, Roemer, W and Schreiber, G (2000) Stimulation and scavestrogen-induced inhibition of reactive oxygen species generated by rat Sertoli cells. Arch Androl 44, 147-54
Crossref   Medline   1st Citation  

Hiraishi, H, Terano, A, Ota, S, Mutoh, H, Sugimoto, T, Razandi, M and Ivey, KJ (1991) Antioxidant defenses of cultured gastric cells against oxygen metabolites: role of GSH redox cycle and endogenous catalase. Am J Physiol 261, G921-8
Medline   1st Citation  

Hottiger, MO, Hassa, PO, Lüscher, B, Schüler, H and Koch-Nolte, F (2010) Toward a unified nomenclature for mammalian ADP-ribosyltransferases. Trends Biochem Sci 35, 208-19
Crossref   Medline   1st Citation  

Kagi, JH and Schaffer, A (1988) Biochemistry of metallothionein. Biochemistry 27, 8509-15
Crossref   Medline   1st Citation   2nd  

Kun, E, Kirsten, E, Bauer, PI and Ordahl, CP (2006) Quantitative correlation between cellular proliferation and nuclear poly (ADP-ribose) polymerase (PARP-1). Int J Mol Med 17, 293-300
Medline   1st Citation  

Lanza, C, Morando, S, Voci, A, Canesi, L, Principato, MC, Serpero, L, Mancardi, G, Uccelli, A and Vergani, L (2009) Neuroprotective mesenchymal stem cells are endowed with a potent antioxidant effect in vivo. J Neurochem 110, 1674-84
Crossref   Medline   1st Citation  

Lee, YS, Yoon, HJ, Oh, JH, Park, HJ, Lee, EH, Song, CW and Yoon, S (2009) 1,3-Dinitrobenzene induces apoptosis in TM4 mouse Sertoli cells: involvement of the c-Jun N-terminal kinase (JNK) MAPK pathway. Toxicol Lett 189, 145-51
Crossref   Medline   1st Citation  

Liebermann, DA, Hoffman, B and Vesely, D (2007) p53 induced growth arrest versus apoptosis and its modulation by survival cytokines. Cell Cycle 6, 166-70
Crossref   Medline   1st Citation  

Maymon, BB, Cohen-Armon, M, Yavetz, H, Yogev, L, Lifschitz-Mercer, B, Kleiman, SE, Botchan, A, Hauser, R and Paz, G (2006) Role of poly (ADP-ribosyl) ation during human spermatogenesis. Fertil Steril 86, 1402-7
Crossref   Medline   1st Citation   2nd  

Meyer-Ficca, ML, Scherthan, H, Bürkle, A and Meyer, RG (2005) Poly (ADP-ribosyl) ation during chromatin remodeling steps in rat spermiogenesis. Chromosoma 114, 67-74
Crossref   Medline   1st Citation  

Mocchegiani, E, Muzzioli, M, Giacconi, R, Cipriano, C, Gasparini, N, Franceschi, C, Gaetti, R, Cavalieri, E and Suzuki, H (2003) Metallothioneins/PARP-1/IL-6 interplay on natural killer cell activity in elderly: parallelism with nonagenarians and old infected humans. Effect of zinc supply. Mech Ageing Dev 124, 459-68
1st Citation  

Palmero, S, Maggiani, S and Fugassa, E (1988) Nuclear triiodothyronine receptors in rat Sertoli cells. Mol Cell Endocrinol 58, 253-6
Crossref   Medline   1st Citation  

Palombi, F and Di Carlo, C (1988) Alkaline phosphatase is a marker for myoid cells in cultures of rat peritubular and tubular tissue. Biol Reprod 39, 1101-5
Crossref   Medline   1st Citation  

Peltola, V, Huhtaniemi, I and Ahotupa, M (1992) Antioxidant enzyme activity in the maturing rat testis. J Androl 13, 450-5
Medline   1st Citation  

Petersen, C and Soeder, O (2006) The Sertoli cell – a hormonal target and ‘super’ nurse for germ cells that determines testicular size. Horm Res 66, 153-61
Crossref   Medline   1st Citation   2nd  

Pfaffl, MW, Horgan, GW and Dempfle, L (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 9, 30-6
1st Citation  

Quesada, P, Atorino, L, Cardone, A, Ciarcia, G and Farina, B (1996) Poly (ADPribosyl) ation system in rat germinal cells at different stages of differentiation. Exp Cell Res 226, 183-90
Crossref   Medline   1st Citation   2nd  

Rouleau, M, Patel, A, Hendzel, MJ, Kaufmann, SH and Poirier, GG (2010) PARP inhibition: PARP1 and beyond. Nat Rev Cancer 10, 293-301
Crossref   Medline   1st Citation  

Schreiber, V, Dantzer, F, Amé, JC and de Murcia, G (2006) Poly (ADP-ribose): novel function for an old molecule. Nat Rev Mol Cell Biol 7, 517-20
Crossref   Medline   1st Citation  

Segal, AW and Abo, A (1993) The biochemical basis of the NADPH oxidase of phagocytes. Trends Biochem Sci 18, 43-7
Crossref   Medline   1st Citation  

Sharpe, RM, McKinnell, C, Kivlin, C and Fisher, JS (2003) Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction 125, 769-84
Crossref   Medline   1st Citation   2nd   3rd  

Sigel, A, Siegel, H and Siegel, RKO (2009) Metallothioneins and related chelators. In Metal Ions in Life Sciences Series vol. 5, Cambridge, U.K., Royal Society of Chemistry,
1st Citation  

Skinner, MK and Griswold, MD (1980) Sertoli cells synthesize and secrete transferring-like protein. J Biol Chem 255, 9523-5
Medline   1st Citation  

Sohal, RS, Allen, RG and Nations, C (1988) Oxidative stress and cellular differentiation. Ann NY Acad Sci 551, 59-73
Crossref   Medline   1st Citation  

Suttorp, N, Toepfer, W and Roka, L (1986) Antioxidant defense mechanisms of endothelial cells: glutathione redox cycle versus catalase. Am J Physiol 251, C671-80
Medline   1st Citation  

Thirumoorthy, N, Manisenthil Kumar, KT, Shyam Sundar, A, Panayappan, L and Chatterjee, M (2007) Metallothionein: an overview. World J Gastroenterol 13, 993-6
Medline   1st Citation   2nd  

Vandesompele, J, De Preter, K, Pattyn, F, Poppe, B, Van Roy, N, De Paepe, A and Speleman, F (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 18, 3-7
1st Citation  

Vergani, L, Lanza, C, Borghi, C, Scarabelli, L, Panfoli, I, Burlando, B, Dondero, F, Viarengo, A and Gallo, G (2007) Effects of growth hormone and cadmium on the transcription regulation of two metallothionein isoforms. Mol Cell Endocrinol 263, 29-37
Crossref   Medline   1st Citation  

Wahab-Wahlgren, A, Holst, M, Ayele, D, Sultana, T, Parvinen, M, Gustafsson, K, Granholm, T and Soder, O (2000) Constitutive production of interleukin-lalpha mRNA and protein in the developing rat testis. Int J Androl 23, 360-5
Crossref   Medline   1st Citation  


Received 17 June 2010/27 December 2010; accepted 4 March 2011

Published as Cell Biology International Immediate Publication 4 March 2011, doi:10.1042/CBI20100454


© The Author(s) Journal compilation © 2011 Portland Press Limited


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)