Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2011) 35, 45–49 (Printed in Great Britain)
Cytoplasmic and nuclear localization of cadherin in honey bee (Apis mellifera L.) gonads
Mônica M Florecki1 and Klaus Hartfelder
Departamento de Biologia Celular e Molecular e Bioagentes Patognicos, Faculdade de Medicina de Ribeiro Preto, Universidade de So Paulo, Ribeiro Preto, SP, Brazil


1To whom correspondence should be addressed (email mmflorec@usp.br).


This supplementary data is also available as a PDF

SUPPLEMENTARY ONLINE DATA



Figure S1 Cadherin detected by Western blot analysis in ovaries of adult honeybee queens and in testes of drone larvae

A cadherin-immunoreactive protein of slightly over 300 kDa was detected in both ovary and testis homogenates. In ovary samples, the antibody also reacted with a protein of approximately 180 kDa (markers: 170 and 220 kDa) which, according to molecular mass, could be vitellin, thus representing unspecific binding to a prominent ovarian protein.


Table S1 Gene-specific primers for the amplification of five A. mellifera cadherins

Primer design was based upon the genomic predictions of cadherin gene family members.

Gene name Primers BPa TMb (°C)
shotgun F1 5′ TGTTGGACAGGGATGAACCG 3′ 355 60
R1 5′ TTGTAATCCGGCACTTTGTCG 3′
F2 5′ AATGACAGCGCACGATTTCG 3′ 351 60
R2 5′ACCGTGCTGGCATTCAGATAGC 3′
N-cadherin F1 5′ CGGTTACCTGTTGACGAGCA 3′ 424 58
R1 5′ GGACGTCAAGAACCTAACGA 3′
F2 5′ GATCTGGACGATTGGGACCT 3′ 231 60
R2 5′ AGAGTTCAGCACAGCCTCGT 3′
starry night F1 5′ GCAACATTGGTGGTCCTGGT 3′ 261 45
R1 5′ GGTAGACTCGTAGTCGAGAG 3′
F2 5′ CGTCAACGTATAGTGGAGCA 3′ 333 45
R2 5′ CCTCGTCAGAACTATAGAAA 3′
fat F 5′ CGAGTACACGTTGGACATCG 3′ 407 45
R 5′ CCTGGATCGAGACTATTACC 3′
fat-like F 5′ CGAAGGACGAGTACGC 3′ 301 60
R 5′ TCGTACACGCTGATGTTGAGG 3′


aProduct size in base pairs.

bMelting temperature.


Received 18 May 2010/29 June 2010; accepted 24 August 2010

Published as Cell Biology International Immediate Publication 24 August 2010, doi:10.1042/CBI20100333


© The Author(s) Journal compilation © Portland Press Limited


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)