About
Published on behalf of the International Federation for Cell Biology
| Cancer |  |
Cell death | |
Cell cycle | |
Cytoskeleton | |
Exo/endocytosis | |
Differentiation | |
Division | |
Organelles | |
Signalling | |
Stem cells | |
Trafficking |
|
|
Cell Biology International (2012) 36, 63–69 (Printed in Great Britain)
Bak Foong Pills induce an analgesic effect by inhibiting nociception via the somatostatin pathway in mice
Dewi Kenneth Rowlands, Yu Gui Cui, Siu Cheung So, Lai Ling Tsang, Yiu Wa Chung and Hsiao Chang Chan1
Epithelial Cell Biology Research Centre, School of Biomedical Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong
Dysmenorrhoea, defined as cramping pain in the lower abdomen occurring before or during menstruation, affects, to varying degrees, up to 90% of women of child-bearing age. We investigated whether BFP (Bak Foong Pills), a traditional Chinese medicine treatment for dysmenorrhoea, possesses analgesic properties. Results showed that BFP was able to significantly reduce pain responses following subchronic treatment for 3 days, but not following acute (1 h) treatment in response to acetic acid-induced writhing in C57/B6 mice. The analgesic effect was not due to inhibition of COX (cyclo-oxygenase) activity, evidenced by the lack of inhibition of prostacyclin and PGE2 (prostaglandin E2) production. Molecular analysis revealed that BFP treatment modulated the expression of a number of genes in the spinal cord of mice subjected to acetic acid writhing. RT–PCR (reverse transcription–PCR) analysis of spinal cord samples showed that both sst4 (somatostatin receptor 4) and sst2 receptor mRNA, but not μOR (μ-opiate receptor) and NK1 (neurokinin-1) receptor mRNA, were down-regulated following BFP treatment, thus implicating somatostatin involvement in BFP-induced analgesia. Administration of c-som (cyclo-somatostatin), a somatostatin antagonist, prior to acetic acid-induced writhing inhibited the analgesic effect. Thus subchronic treatment with BFP has anti-nociceptive qualities mediated via the somatostatin pathway. Key words: analgesia, Bak Foong Pills (BFP), dysmenorrhoea, somatostatin Abbreviations: BFP, Bak Foong Pills, COX, cyclo-oxygenase, c-som, cyclo-somatostatin, GAPDH, glyceraldehyde-3-phosphate dehydrogenase, GPCR, G-protein-coupled receptor, IL, interleukin, NK1, neurokinin-1, PG, prostaglandin, RT–PCR, reverse transcription–PCR, sst, somatostatin receptor, μOR, μ-opiate receptor 1To whom correspondence should be addressed (email hsiaocchan@cuhk.edu.hk). 1. Introduction The underlying causes of primary dysmenorrhoea, defined as painful menstruation occurring in the absence of detectable pelvic disease (Hendrix and Alexander, 2002), are believed to be due to a number of factors, but are mainly attributed to hormonal influences, increased myometrial activity and increased PG (prostaglandin) production, leading to abdominal discomfort and pain (Deligeoroglou, 2000; Nasir and Bope, 2004). The increase in PGs, predominantly PGF2α and PGE2, not only causes uterine contraction and vasoconstriction, but may also contribute to the hyperalgesic effect of sensitizing sensory neurons to further pain with PGE2 and prostacyclin (PGI2) released from inflamed uterine tissue (Jabbour and Sales, 2004). For these reasons, the main treatment strategy for the alleviation of menstrual pain is the use of NSAIDs (non-steroidal anti-inflammatory drugs), which inhibit COX (cyclo-oxygenase), the enzymes that catalyse the conversion of arachadonic acid into the bioactive prostanoids (Samad et al., 2002). Besides the COX pathways, the somatostatin system is also receiving attention as a possible target for the treatment of pain. Somatostatin receptors, which have been implicated in the modulation of nociceptive signals at the level of the spinal cord and are known to be either co-localized or in close proximity to substance P-containing neurons, are differentially regulated during acute and chronic inflammation (Selmer et al., 2000; Abd El-Aleem et al., 2005). The use of BFP (Bak Foong Pills), which consists of some 20 herbal constituents (see Gou et al., 2003, for full list) as a traditional anti-dysmenorrhoeal in China, is common, with anecdotal evidence suggesting that it is effective in reducing menstrual pain. As mentioned in our previous publications, BFP may work via stimulating production of oestrogen or progesterone, or may indirectly alleviate abdominal pain via relaxation of the uterus through genomic mechanisms (Rowlands et al., 2009). Indeed, the use of oestrogen in the form of the combined oral contraceptive to treat dysmenorrhoeal pain is also well documented, oestrogen being known to alter the perception of pain and uterine quiescence (Rowlands et al., 2009). But there is no evidence of BFP having a direct hormonal action (Wise, 2002; Aloisi, 2003; Czlonkowska et al., 2003). The present investigation thus aimed at confirming possible analgesic effects of BFP and elucidating the possible underlying mechanism using an animal model of abdominal pain. 2. Materials and methods 2.1. Reagents Acetic acid was purchased from Merck; indomethacin, c-som (cyclo-somatostatin) from Sigma–Aldrich, BFP from Eu Yan Sang (HK), PG RIA kits from Amersham Bioscience and Atlas Mouse 1.2 Array II kit from BD Bioscience Clontech. 2.2. Animals Specified pathogen-free C57/B6 mice were obtained from the Chinese University Laboratory Animal Services Centre, were housed in a 12 h light/12 h dark and temperature-controlled (21–24°C) environment and were provided food and water ad libitum (except that food was withdrawn for 6 h prior to writhing assay). Animal procedures were conducted under licence from the Hong Kong Government Department of Health, and according to procedures approved by the Institutional Animal Experimental Ethics Committee, The Chinese University of Hong Kong (approval number 01/031/MIS). 2.3. Writhing assay Induction of noxious stimuli for the assessment of the analgesic effect was performed using the acetic acid-induced writhing model of abdominal pain. Briefly, adult C57/B6 mice (40 g, male) were divided into six groups and treated either acutely (once in 24 h) or subchronically (3 times in 72 h) with BFP (2 g·kg−1·day−1, per os), with indomethacin (1 mg·kg−1 per 24 h, per os) or with vehicle (0.4 ml/24 h, water). At 1 h following the last dose, acetic acid (0.5%, 0.2 ml, intraperitoneal) was injected and the writhing response measured. Writhes, defined as a pronounced stretching of the hind and fore limbs, were counted for 30 min after injection and calculated as percentage inhibition [(writhes of vehicle group−writhes of treated group)/writhes of water group×100%] as described by Doherty et al. (1987). Furthermore, to investigate any dose–response relationship, additional mice were treated with varying doses of BFP (0.25, 0.5, 1 and 5 g·kg−1·day−1, per os) or vehicle (0.5 ml/day, water) for 3 days. On the third day, the writhing responses induced by injection of acetic acid (0.5%, 0.2 ml intraperitoneal) were observed 1 h after the last dosing and expressed as the number of writhes per 30 min. Possible involvement of somatostatin in BFP-induced analgesia was assessed following a single administration of a somatostatin receptor antagonist, c-som (50 μg intraperitoneal), 1 h prior to acetic acid injection in subchronically treated BFP or vehicle-treated animals. Again writhes were counted for 30 min after injection and calculated and expressed as the number of writhes per 30 min. Spinal cords extracted immediately after killing the mice were snap-frozen in liquid nitrogen and stored at −70°C for DNA microarray and RT–PCR (reverse transcription–PCR) analysis. 2.4. PG measurement Immediately following the 30 min acetic acid writhing response, the animals were killed, an intraperitoneal lavage with saline was done by injecting 2 ml of saline into a small incision made on the left peritoneal wall. Following flushing, ∼1 ml of peritoneal wash was recovered (which was stored at −20°C until assay) and assayed for the presence of the PGs, PGE2 and 6-keto-PGF1α (the primary metabolite of prostacyclin) using RIA according to the manufacturer's instructions. 2.5. DNA microarray Total RNA samples from each group were digested with RNase-free DNase I and reverse-transcribed. cDNA samples were labelled with [32P]deoxyadenosine triphosphate (Amersham Bioscience) using a primer mix for 1176 genes in the Atlas Mouse 1.2 Array II kit (BD Bioscience Clontech). The labelled cDNA samples were separately hybridized against a pair of identical nylon membranes for which each cDNA was represented as a single spot distributed in panels of functionally related genes. The radioactive signals were visualized by a phosphor imaging system, PhosphoImager screens, Cyclone (Packer Bioscience), and a comparison of the intensities of each signal was performed using BD AtlasImage™ 2.7 software (BD Bioscience Clontech). Values were corrected for differences in hybridization efficiency between the 2 membranes (BFP versus vehicle) by dividing the average expression of all genes in the respective arrays (‘global normalization’). Adjusted values with relative differences in gene expression of >3-fold up-regulation or down-regulation were selected. 2.6. RT–PCR RNA extraction and RT–PCR were carried out within 1 week of spinal cord harvest. The specific oligonucleotide primers for GAPDH (glyceraldehyde-3-phosphate dehydrogenase; NM_008084) were: ACCACAGTCCATGCCATCAC (sense) and TCCACCACCCTGTTGCTG TA (antisense), corresponding to nt 566–1017 with expected cDNA of 452 bp. The specific oligonucleotide primers for sst4 (somatostatin receptor 4; NM_009219) were ATCAACCTGGGAGTGTGG (sense) and CGGAAGTTGTCAGAGAGG (antisense), corresponding to nt 569–1029 with expected cDNA of 461 bp. sst2 (NM_009217): TCTACGCCTTCATCCTGG (sense) and TGCTTACTGTCGCTCCTC (antisense), corresponding to nt 652–1057 with expected cDNA of 406 bp. μOR (μ-opiate receptor; NM_001039652): CGGTCCTCATCATCACTG (sense) and ACTGTATTAGCCGTGGAG (antisense), corresponding to nt 986–1394 with expected cDNA of 409 bp. NK1 (neurokinin-1) receptor (NM_009313): GCTGGTGATTGGCTATGC (sense) and TGATGAAAGGGCAGCAGC (antisense), corresponding to nt 1200-1552 with expected cDNA of 353 bp. The reaction conditions for all primers were: denaturation at 94°C for 45 s; annealing at 53, 58 and 59°C for 60 s; extension at 72°C for 60 s; 30 cycles. The intensities of the bands of all tested receptors were normalized to that of GAPDH, which was simultaneously amplified. 2.7. Data analysis Statistical comparisons were performed using a one-way ANOVA, followed by the Newman–Keuls test to compare groups. 3. Results 3.1. Writhing assay Writhing assays were performed as described in Doherty et al. (1987). Interperitoneal injection of acetic acid caused significant writhing response in C57/B6 male mice, with the response in vehicle (water, 10 ml/kg, per os)-treated animals to acetic acid (41.41±1.90, n = 12) being elicited. One hour following treatment with indomethacin (1 mg/kg, per os) the acetic acid-induced writhing response was significantly reduced compared with vehicle-treated animals, with indomethacin inhibiting the acetic acid response by 87.21±3.8% (n = 8; Figure 1). Acute (1 h) BFP (2 g/kg, per os) treatment, however, had no significant effect (Figure 1). Daily treatment with indomethacin (1 mg·kg−1·day−1, per os) for 3 days showed continued inhibition of acetic acid-induced writhing (89.02±3.07%, n = 11), as did daily treatment with BFP (2 g·kg−1·day−1, per os) with significant inhibition of the writhing response induced by acetic acid (62.37±5.16%, n = 12) compared with vehicle-treated animals (Figure 1). BFP-induced inhibition of writhing was dose-dependent (Figure 2). 3.2. PG production The possible involvement of COX inhibition in the BFP-induced analgesia was investigated by measuring PGE2 and PGI2 (in the form of 6-keto PGF1α) from peritoneal washes of mice subjected to acetic acid-induced writhing and treatment with BFP (2 g·kg−1·day−1, per os), indomethacin (1 g·kg−1·day−1, per os) or vehicle (water, 10 ml/kg, per os) for 3 days. RIA results showed significant decreases in the levels of both 6-keto PGF1α and PGE2 following indomethacin, but not BFP, treatment (Figure 3), indicating that the effect of BFP is mediated by pathway(s) different from that of COX. 3.3. DNA microarray To identify possible pathways involved in mediating the BFP analgesic effect, spinal cord samples from mice, subchronically treated with BFP (3 g·kg−1·day−1, per os) or vehicle (10 ml·kg−1·day−1 water, per os) and assessed for the analgesic effect using acetic acid-induced writhing, were screened for differential expression of genes using the Atlas Mouse 1.2 Array II DNA microarray kit. Of the 1170 genes tested, only 8 gene expression levels showed >3-fold differences between the groups, all the identified genes being down-regulated following BFP treatment. The down-regulated genes included apolipoprotein CII, high-mobility group protein 14, IL-10 (interleukin-10) receptor α precursor, IL-10 receptor β, IL-9 receptor, sst4, GPCR7 (G-protein-coupled receptor 7), guanylate cyclase activator 2b (see Table 1 for gene identification numbers). No significant expression changes were observed in any of the other likely neuroreceptor target genes included on the array (see Table 2), including opiate receptors δ (delta), κ (kappa) and σ (sigma) or seretoninergic, histaminergic, dopaminergic and prostanoid receptor systems, which have well-known relationships to pain mediation (Scholz and Woolf, 2002; Blackburn-Munro and Blackburn-Munro, 2003). Additionally, no expression level differences in the sex hormone-related receptors of oestrogen, progesterone or oxytocin were detected in the spinal cord following BFP treatment, excluding involvement of these hormones. Table 1 Differential expression of genes following subchronic treatment with vehicle or FP
Expression values represent a >3-fold difference between vehicle and BFP-treated groups.
Table 2 Genes of interest included in the array
3.4. Confirmation of gene expression by semi-quantitative RT–PCR To confirm some of the findings of the DNA microarray and test additional receptors known to be involved in pain response but not included on the array, RT–PCR was carried out on spinal cord samples of subchronic BFP, indomethacin or vehicle-treated animals following acetic acid-induced writhing, with primers for sst2, sst4, μOR and NK1 receptors. Semi-quantitative RT–PCR results (Figure 4) demonstrated that, as in the DNA array results, sst4 was also down-regulated following BFP treatment (Figure 4A). The related somatostatin receptor subtype sst2 was also down-regulated by BFP (Figure 4B). However, neither μOR nor the NK1 receptors showed any significant expression differences following BFP treatment (Figures 4C and 4D). Indomethacin treatment had no significant effect on expression levels of any of the genes examined (Figure 4). 3.5. Effect of somatostatin antagonist on BFP-induced analgesia The possible involvement of somatostatin in the BFP-induced analgesia was further investigated using c-som, a non-selective somatostatin receptor antagonist, prior to acetic acid-induced writhing. Subchronic BFP (3 g·kg−1·day−1, per os) treatment significantly reduced the writhing response compared with subchronic vehicle (10 ml·kg−1·day−1 water, per os) administration (Figure 5). Following c-som administration, however, the analgesic effect of BFP was abolished, and the writhing levels returned to levels seen in vehicle-treated and vehicle plus c-som-treated animals. 4. Discussion and conclusions The reported anti-dysmenorrhoeal effects of BFP have so far been attributed to the hormonal influences of oestrogen and progesterone, and also the apparent ability of BFP and its component herbs to influence uterine contractility (Rowlands et al., 2009). However, another major factor in the aetiology of the condition is increased perception of pain experienced during menstruation. Indeed, the widespread use of analgesics by dysmenorrhoeal women, with as many as 80% of women reporting to use some form of analgesia, provides evidence for the importance of pain alleviation in the treatment of dysmenorrhoea (Collins Sharp et al., 2002). The present study thus investigated whether the overall beneficial effects of BFP for the treatment of dysmenorrhoea were influenced and aided by analgesic action. Since the main source of pain during dysmenorrhoea appears to be due to excessive PG release in the abdomen (Jabbour and Sales, 2004), an abdominal model of pain in mice was employed. Acetic acid-induced writhing responses have previously been attributed, at least partly, to increased PG release (Doherty et al., 1987). The two major prostanoids thought to be involved are prostacyclin (PGI2) and PGE2, with prostacyclin believed to be responsible for direct pain mediation and PGE2 being involved in hyperalgesia (Samad et al., 2002). As demonstrated in the writhing study, BFP was unable to significantly inhibit acetic acid writhing following 1 h of acute treatment, whereas indomethacin, as anticipated, significantly reduced painful response (Figure 1). However, following subchronic (72 h) treatment with BFP, the acetic acid-induced response demonstrated significant inhibitory effect (Figure 1). The analgesic effect of BFP does not seem to be mediated by action on the PG production/release pathway. Centrally acting analgesics, such as morphine and clonidine, can also reduce acetic acid-induced writhing without decreasing prostacyclin production, perhaps indicating the involvement of inhibition of centrally acting pain pathways (Doherty et al., 1987). The fact that BFP appeared to have analgesic response only after subchronic treatment, but not following acute treatment in acetic acid writhing tests, also suggests that BFP's inhibition of the writhing response is likely to be due to genomic effects and possible alteration of pain mediator expression levels, and not via simple inhibition or antagonism of pain mediators. DNA microarray analysis of subchronic BFP- and vehicle-treated mice compared differential expression levels of almost 1200 genes. Included in the array were over 50 nociceptive-related genes (Tables 2A and 2B), including opiate, nerve growth factor, serotoninergic, histaminergic, purinergic, dopaminergic, prostanoid and somatostatin systems. Additionally, reproductive genes of interest that have previously been linked to BFP, such as oestrogen, progesterone and oxytocin, were included. Of the genes tested following treatment, 8 gene expression levels were >3-fold different from the controls, all of the identified genes being down-regulated (Table 1). Interestingly, despite the possible involvement of reproductive hormones, oestrogen and progesterone, in mediating the anti-dysmenorrhoeal effect of BFP as previously indicated (Rowlands et al., 2009), oestrogen, progesterone or oxytocin receptor mRNA levels were unaltered in spinal cord following BFP treatment. The hormonal effect of BFP thus appears not to be involved in the direct analgesic effect of BFP, a notion supported by our previous finding that oestrogen does not inhibit acetic acid-induced writhing (results not shown). A literature search of the identified genes for possible connection to pain and inflammation revealed that high-mobility group protein 14 and guanylate cyclase activator 2b had no apparent link to BFP's analgesic mechanism according to currently known mechanisms. However, apolipoprotein CII was linked to hypertriglyceridaemia and abdominal pain (Baggio et al., 1986), whereas IL-10 was identified as an important regulator of pro-inflammatory responses (Schneider et al., 2004); IL-9 as an allergic inflammatory mediator (Soussi-Gounni et al., 2001); GPCR7, a novel human opioid-somatostatin-like receptor gene (O'Dowd et al., 1995); and sst4 as a nociceptive transmission inhibitor (Schreff et al., 2000). The precise role of most of these anti-inflammatory and analgesic mediators in the BFP-induced analgesia remains unclear due to limited data available on the genes concerned. However, sst4 is involved in pain inhibition and is widely distributed in pain processing areas of the central nervous system, such as the hypothalamus, thalamus and spinal cord, although the precise mechanism is not clearly understood (Fehlmann et al., 2000; Schreff et al., 2000; Selmer et al., 2000; Bar et al., 2004). Indeed, semi-quantitative RT–PCR has confirmed down-regulation of sst4 receptor as well as the closely related sst2 receptor mRNA levels by BFP treatment. Other genes of interest not included on the array for the μOR and NK1 receptors (Figures 4C and 4D), but included in the RT–PCR analysis, were however not altered by BFP treatment, thus confirming that BFP specifically targets changes in the somatostatin system and does not involve expression changes in opiate, neurokinin or other major nociceptive pathways. Since other reports have shown that increase in endogenous somatostatin and somatostatin analogues can decrease the response in acetic acid-induced writhing in mice, the reason why the sst receptor mRNA levels would be down-regulated following BFP treatment is unclear (Szolcsanyi et al., 2004). However, as with opiate receptors, somatostatin receptors are rapidly down-regulated following continued exposure to agonist (Schreff et al., 2000; Csaba and Dournaud, 2001). The regulation of somatostatin receptor levels also appears to be multiphasic in response to changes in expression levels being dependent on the time course following a nociceptive stimulus (Petersenn et al., 2002; Bar et al., 2004). Increase in somatostatin peptide mRNA levels is also been differentially regulated throughout the nociceptive and hyperalgesic responses; together with receptor expression changes they are believed to provide a balance between pro-nociceptive and anti-nociceptive responses (Abd El-Aleem et al., 2005). Since no somatostatin mRNA changes were observed following microarray analysis in this study, the results suggest that BFP exerts its analgesic effect by increased somatostatin release as opposed to increased somatostatin production, thus leading to receptor mRNA down-regulation. The involvement of somatostatin in the BFP-induced analgesia was investigated in vivo using the somatostatin antagonist, c-som. Again, subchronic treatment with BFP significantly reduced the nociceptive effect of acetic acid. However, c-som treatment 1 h prior to acetic acid injection completely inhibited the analgesic response of BFP (Figure 5). Our results are in agreement with previous studies demonstrating that c-som injection can significantly inhibit the analgesic effect of somatostatin and somatostatin analogues, thus confirming that stimulation of somatostatin receptors is an important mechanism for the BFP-induced analgesia (Carlton et al., 2001). The mechanism by which BFP promotes an increase in somatostatin release to produce analgesia remains unknown. Work by others has demonstrated that some neurotrophic factors, such as GDNF (glial-derived neurotrophic factor), can increase the content of somatostatin in the dorsal horn of the spinal cord and may increase its release during nociceptive events (Malcangio, 2003). The subchronic time frame of the BFP-induced analgesia would be in line with the possible indirect effect of BFP, via its action on neurotrophic factors, to increase somatostatin levels (Ivanova et al., 2002). Further studies will be required to confirm this possibility. In conclusion, we have demonstrated that subchronic treatment of BFP has analgesic action mediated via the somatostatin pathway, an area of increasing interest in pain research. BFP appears to be an effective analgesic and may be an appropriate treatment for relief from dysmenorrhoeal pain. Further identification of BFP's active ingredients and the underlying mechanisms may also lead to novel analgesic agents targeting the currently underexploited somatostatin pathway. Author contribution Dewi Kenneth Rowlands designed, conducted and analysed the experimental work, with assistance from Yu Gui Cui and Yiu Wa Chung for the behavioural data, Siu Cheung So for the RIA and Lai Ling Tsang for the molecular analysis. Dewi Kenneth Rowlands and Hsiao Chang Chan authored the paper. Funding This work was supported by the Innovation and Technology Fund of the REFERENCES Abd El-Aleem, SA, Morales-Aza, BM, McQueen, DS and Donaldson, LF (2005) Inflammation alters somatostatin mRNA expression in sensory neurons in the rat. Eur J Neurosci 21, 135-41 Aloisi, AM (2003) Gonadal hormones and sex differences in pain reactivity. Clin J Pain 19, 168-74 Baggio, G, Manzato, E, Gabelli, C, Fellin, R, Martini, S and Enzi, GB (1986) Apolipoprotein C-II deficiency syndrome. Clinical features, lipoprotein characterization, lipase activity, and correction of hypertriglyceridemia after apolipoprotein C-II administration in two affected patients. J Clin Invest 77, 520-7 Bar, KJ, Schurigt, U, Scholze, A, Segond, VB, Stopfel, N and Brauer, R (2004) The expression and localization of somatostatin receptors in dorsal root ganglion neurons of normal and monoarthritic rats. Neuroscience 127, 197-206 Blackburn-Munro, G and Blackburn-Munro, R (2003) Pain in the brain: are hormones to blame? Trends Endocrinol Metab 14, 20-7 Carlton, SM, Du, J, Zhou, S and Coggeshall, RE (2001) Tonic control of peripheral cutaneous nociceptors by somatostatin receptors. J Neurosci 21, 4042-9 Collins Sharp, BA, Taylor, DL, Thomas, KK, Killeen, MB and Dawood, MY (2002) Cyclic perimenstrual pain and discomfort: the scientific basis for practice. J Obstet Gynecol Neonatal Nurs 31, 637-49 Csaba, Z and Dournaud, P (2001) Cellular biology of somatostatin receptors. Neuropeptides 35, 1-23 Czlonkowska, A, Ciesielska, A and Joniec, I (2003) Influence of estrogens on neurodegenerative processes. Med Sci Monit 9, RA247-56 Deligeoroglou, E (2000) Dysmenorrhea. Ann NY Acad Sci 900, 237-44 Doherty, NS, Beaver, TH, Chan, KY, Coutant, JE and Westrich, GL (1987) The role of prostaglandins in the nociceptive response induced by intraperitoneal injection of zymosan in mice. Br J Pharmacol 91, 39-47 Fehlmann, D, Langenegger, D, Schuepbach, E, Siehler, S, Feuerbach, D and Hoyer, D (2000) Distribution and characterisation of somatostatin receptor mRNA and binding sites in the brain and periphery. J Physiol Paris 94, 265-81 Gou, YL, Ho, AL, Rowlands, DK, Chung, YW and Chan, HC (2003) Effects of Bak Foong Pill on blood coagulation and platelet aggregation. Biol Pharm Bull 26, 241-6 Hendrix, SL and Alexander, NJ (2002) Primary dysmenorrhea treatment with a desogestrel-containing low-dose oral contraceptive. Contraception 66, 393-9 Ivanova, T, Karolczak, M and Beyer, C (2002) Estradiol stimulates GDNF expression in developing hypothalamic neurons. Endocrinology 143, 3175-8 Jabbour, HN and Sales, KJ (2004) Prostaglandin receptor signalling and function in human endometrial pathology. Trends Endocrinol Metab 15, 398-404 Malcangio, M (2003) GDNF and somatostatin in sensory neurones. Curr Opin Pharmacol 3, 41-5 Nasir, L and Bope, ET (2004) Management of pelvic pain from dysmenorrhea or endometriosis. J Am Board Fam Pract 17, Suppl., S43-7 O'Dowd, BF, Scheideler, MA, Nguyen, T, Cheng, R, Rasmussen, JS and Marchese, A (1995) The cloning and chromosomal mapping of two novel human opioid-somatostatin-like receptor genes, GPR7 and GPR8, expressed in discrete areas of the brain. Genomics 28, 84-91 Petersenn, S, Rasch, AC, Presch, S, Beil, FU and Schulte, HM (2002) Characterization of the human somatostatin receptor type 4 promoter. Mol Cell Endocrinol 188, 75-83 Rowlands, DK, Cui, YG, Wong, HY, Gou, YL and Chan, HC (2009) Traditional Chinese medicine Bak Foong Pills alters uterine quiescence-possible role in alleviation of dysmenorrhoeal symptoms. Cell Biol Int 33, 1207-11 Samad, TA, Sapirstein, A and Woolf, CJ (2002) Prostanoids and pain: unraveling mechanisms and revealing therapeutic targets. Trends Mol Med 8, 390-6 Schneider, CP, Schwacha, MG and Chaudry, IH (2004) The role of interleukin-10 in the regulation of the systemic inflammatory response following trauma-hemorrhage. Biochim Biophys Acta 1689, 22-32 Scholz, J and Woolf, CJ (2002) Can we conquer pain? Nat Neurosci 5 Suppl:1062-7 Schreff, M, Schulz, S, Handel, M, Keilhoff, G, Braun, H and Pereira, G (2000) Distribution, targeting, and internalization of the sst4 somatostatin receptor in rat brain. J Neurosci 20, 3785-97 Selmer, I, Schindler, M, Allen, JP, Humphrey, PP and Emson, PC (2000) Advances in understanding neuronal somatostatin receptors. Regul Pept 90, 1-18 Soussi-Gounni, A, Kontolemos, M and Hamid, Q (2001) Role of IL-9 in the pathophysiology of allergic diseases. J Allergy Clin Immunol 107, 575-2 Szolcsanyi, J, Bolcskei, K, Szabo, A, Pinter, E, Petho, G and Elekes, K (2004) Analgesic effect of TT-232, a heptapeptide somatostatin analogue, in acute pain models of the rat and the mouse and in streptozotocin-induced diabetic mechanical allodynia. Eur J Pharmacol 498, 103-9 Wise, PM (2002) Estrogens and neuroprotection. Trends Endocrinol Metab 13, 229-30 Received 8 January 2011; accepted 10 October 2011 Published as Cell Biology International Immediate Publication 10 October 2011, doi:10.1042/CBI20110015 © The Author(s) Journal compilation © 2012 Portland Press Limited |
ISSN Print: 1065-6995
ISSN Electronic: 1095-8355 Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB) |
Abstract
