Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2012) 36, 189–194 (Printed in Great Britain)
Production of canine mesenchymal stem cells from adipose tissue and their application in dogs with chronic osteoarthritis of the humeroradial joints
Annalisa Guercio*, Patrizia Di Marco*, Stefania Casella†1, Vincenza Cannella*, Laura Russotto*, Giuseppa Purpari*, Santina Di Bella* and Giuseppe Piccione†
*Area Diagnostica Virologica dellIstituto Zooprofilattico Sperimentale della Sicilia A Mirri, Palermo, Italy, and †Dipartimento di Scienze Sperimentali e Biotecnologie Applicate, Facolt di Medicina Veterinaria, Universit degli Studi di Messina, Messina, Italy


Autologous AD-MSC [adipose-derived MSC (mesenchymal stem cell)] therapy involves harvesting fat from the patient by isolating the stem and regenerative cells and administering the cells back to the patient. This study evaluated the production of canine AD-MSCs and their possible application in cellular therapy for dogs. To assess whether cellular therapy can replace drug therapy, the clinical effect of a single intra-articular injection of AD-MSCs was evaluated on 4 dogs with lameness associated with OA (osteoarthritis) of the humeroradial joints. MSCs were readily isolated from adult dog adipose tissue, and their ability to form colony and differentiate into various phenotypes was confirmed. AD-MSCs expressed OCT4, NANOG and SOX2 at the mRNA level, pluripotency markers usually ascribed to embryonic stem cells. The results suggest the stemness of the cells isolated from canine fat, and good quality control made them available for both experimental and clinical use. Follow-up studies to evaluate the effects of AD-MSC therapy showed that OA of the elbow joints improved with time, indicating significant potential for clinical use in the treatment of lameness, particularly when administered before the injury becomes severe.


Key words: autologous adipose-derived mesenchymal stem cell, cellular therapy, dog, humeroradial joint, osteoarthritis

Abbreviations: MSC, mesenchymal stem cell, AD-MSC, adipose-derived MSC, BM, bone marrow, BM-MSC, BM-derived MSC, CFU, colony-forming units, DJD, degenerative joint disease, DMEM, Dulbecco's modified Eagle's medium, FBS, fetal bovine serum, HBSS, Hanks balanced salt solution, OA, osteoarthritis, CP, platelet concentrate, PRP, platelet-rich plasma, PPP, platelet-poor plasma, RT–PCR, reverse transcription–PCR

1To whom correspondence should be addressed (email stefania.casella@unime.it).


1. Introduction

MSCs (mesenchymal stem cells) are non-haematopoietic multipotent stem cells of BM (bone marrow) (Friedenstein et al., 1968), which have since been isolated from other sources, such as cord blood, adipose tissue, fetal lung, amniotic fluid and skeletal muscle (Erices et al., 2000; Campagnoli et al., 2001; Minguell et al., 2001; Caplan and Dennis, 2006; Carrancio et al., 2008; Neupane et al., 2008). In particular, BM-MSCs (BM-derived MSCs) and AD-MSCs (adipose-derived MSCs) are the most highly characterized and are quite comparable (Parker and Katz, 2006). Both have broad multipotency, with differentiation into different cell lineages, including adipo-, osteo- and chondro-cytic lineages (Parker and Katz, 2006; Black et al., 2007). However, the easy and repeatable access to adipose tissue, the simple isolation procedure and the greater numbers of fresh MSCs derived from equivalent amounts of fat versus BM show a clear advantage in using AD-MSCs over BM-MSCs (Fraser et al., 2006; Schaffler and Buchler, 2007; Tonchev et al., 2010). Their stromal vascular fraction contains stem cells, T-lymphocytes, anti-inflammatory macrophages, endothelial precursor cells and preadipocytes; they can differentiate into bone, cartilage, muscle and neuronal cells (Tonchev et al., 2010). Research into AD-MSC therapy in regenerative medicine is rapidly growing, and stem cell therapy is being used to treat inflammatory diseases, including OA (osteoarthritis) (Luyten, 2004;Gimble et al., 2007; Schaffler and Buchler, 2007; Black et al., 2008). Also known as DJD (degenerative joint disease), this is the final common pathway to which all joint disease deteriorates, characterized by synovitis and degeneration of the articular cartilage with loss of matrix, fibrillation and formation of fissures, resulting in complete loss of the cartilage surface (Mortellaro, 2003). OA in dog is by far the most common form of arthritis, affecting ∼20% of the animals. Previous studies of OA therapy have indicated that non-steroidal anti-inflammatory drugs fail to give complete pain relief (Vasseur et al., 1995; Johnson and Budsberg, 1997), and cellular therapies may provide a therapeutic alternative. In contrast with drug therapy, cellular therapies such as treatment with AD-MSCs do not rely on a single target receptor or pathway for their action, but play a trophic function by recruiting endogenous cells to the injured site (Gimble et al., 2007; Chen et al., 2010). For some orthopaedic lesions in dogs, the clinical application of BM-MSCs has been reported (Crovace et al., 2008), but veterinarians have reported beneficial effects of autologous AD-MSCs on lameness in dogs with chronic OA of the coxofemoral joints (Black et al., 2007).

On this basis, the present study reports on the production of canine AD-MSCs and their possible clinical application in the treatment of OA. To assess whether cellular therapy can replace drug therapy, the clinical effect of a single intra-articular injection of AD-MSCs was assessed in dogs with lameness due to OA of the humeroradial joints.

2. Materials and methods

2.1. Animals

Four male dogs of different breeds of 4–8 years of age and body weights from 22 to 70 kg were recruited based on the presence of lameness associated with OA of the humeroradial joints lasting on average 6 months. To be eligible, the dogs had to be cared for by attentive owners who agreed by informed consent to participate in this clinical study, keep a set schedule of veterinary appointments and observe their dogs over the entire study period. Before enrolment, all dogs underwent routine clinical chemistry and haematology tests to ensure overall health. Veterinarians assessed each dog for lameness, pain on manipulation, alteration of range of motion and functional disability. The dogs had not responded to anti-inflammatory drugs, and hence they were treated with AD-MSCs as an alternative therapy that might reduce degeneration of the articular surfaces. Before implanting, AD-MSCs were isolated, amplified, characterized and successively stored. Cells were inoculated in dogs with lameness using PRP (platelet-rich plasma) or hyaluronic acid as scaffolds.

2.2. Culture and expansion of AD-MSCs

AD-MSCs were obtained from subcutaneous, visceral and inguinal fat depots from each dog (autologous implantation), using standard surgical procedures under mild sedation with mededomidine (0.1 ml/kg body weight).

The adipose tissue sample was weighed and digested for 3–4 h at 37°C in collagenase type IA (0.2%) prepared in sterile PBS, supplemented with 1% antibiotics (penicillin, streptomycin and amphotericin). The collagenase type IA activity was neutralized by adding 10% (v/v) FBS (fetal bovine serum; EuroClone). Following centrifugation (300 g and 10 min) and washing of the pellet, cells were incubated (∼2 g of tissue per 25 cm2 flask) in DMEM (Dulbecco's modified Eagle's medium) Low Glucose medium (Gibco) with 20% FBS, in an incubator under a humidified air and 5% CO2 atmosphere. Unattached cells were removed the next day by washing with HBSS (Hanks balanced salt solution; Gibco), supplemented with 1% antibiotics (penicillin, streptomycin and amphotericin). The medium was renewed every 3 days. Adherent cells grown to semiconfluence were harvested, quantified and subcultured. For harvesting viable AD-MSCs, a small volume of sterile and warm HBSS was added to the flasks. HBSS was replaced with 500 μl of trypsin/EDTA solution (0.5%). The medium containing the suspended cells was transferred from the flask to a sterile tube of 15 ml and centrifuged at 300 g for 5 min. The supernatant was aspirated and the cells resuspended in a small volume of culture medium. An aliquot of cells was diluted in Trypan Blue (1:2 dilution) for cell counting automatically in a Cellometer Auto T4 from EuroClone. They were replated in new flasks. Cells were also cryopreserved in DMEM Low Glucose medium with 80% FBS and 10% DMSO (Sigma–Aldrich) for further studies.

The identity of AD-MSCs was verified by their ability to attach to the plastic surface of culture flasks, form CFU (colony-forming units) and differentiate into cells of mesodermal lineages: chondrocytes, adipocytes and osteocytes. The presence of transcription factors indicative of self-renewal and undifferentiation was also investigated.

2.3. CFU assay

The colony forming efficiency on plastic was assayed by plating isolated cells at three different seeding densities (150, 60 and 30 cells/cm2) in 6-well plates in DMEM Low Glucose with 5% FBS. Cells were incubated for 2 weeks in an incubator with humidified air and 5% CO2. The colonies were stained with Giemsa solution and scored.

2.4. Differentiation of AD-MSCs (osteogenesis, chondrogenesis and adipogenesis)

Cells derived from subcutaneous and visceral fat and expanded in the DMEM Low Glucose medium with 20% FBS were used for differentiation studies. The MSCs were cultured in appropriate differentiation media to obtain the 3 mesodermal lineages (osteogenic, chondrogenic and adipogenic). All studies were carried out with the same number of controls.

2.5. Osteogenesis

Cells were plated at 4500 cells/cm2 on 6-well plates and treated with NH OsteoDiff Medium (Mylteny Biotec) for 3 weeks, with a medium change once every 3 days. von Kossa staining was used to detect calcified extracellular matrix deposits.

2.6. Chondrogenesis

Micromass cultures of cells (1×106 cells/ml) were incubated in 15 ml test tubes with NH Chondro Diff Medium (Mylteny Biotec) for 30 days, with a medium change once every 3 days. The micromasses were histologically stained with Alcian Blue to highlight the presence of sulfated proteoglycan-rich matrix.

2.7. Adipogenesis

Cells were plated at 7500 cells/cm2 on 6-well plates, and treated with Complete MesenCult Adipogenic Medium (Stemcell Technologies) for 21 days with a medium change once every 3 days. Oil Red O staining was used to examine lipid droplet formation.

2.8. RT–PCR (reverse transcription–PCR)

Total RNAs were extracted from cells using an RNAspin Mini RNA Isolation kit (GE Healthcare) and treated with DNase I to remove contaminating DNA. cDNAs were synthesized from 1 mg of total RNA using random hexamers and Superscript III reverse transcriptase (Invitrogen). Primers, derived from coding regions of respective genes (OCT4, NANOG and SOX2) in canine genome, were used to amplify the target sites (Table 1). A 25 μl portion of PCR reactions was prepared with 2 μl of cDNA, 5 pmol of each primer, 0.5 unit of Taq polymerase (Invitrogen) and final concentrations of 40 μM dNTPs, 2 mM magnesium chloride, 20 mM Tris/HCl and 50 μl of potassium chloride. Cycling conditions were as follows: 94°C for 4 min; 30–35 cycles at 94°C for 1 min, optimal annealing temperature (60°C for OCT4 and NANOG and 58°C for SOX2) for 1 min, 72°C for 1 min; followed by 72°C for 5 min. The PCR products were separated on 2% agarose gel by electrophoresis, stained with ethidium bromide and visualized under UV light; digital images were captured with Image Lab software.


Table 1 Primers derived from coding regions of respective genes (OCT4, SOX2 and NaNOG) in canine genome

Gene Primer sequence (5′–3′) Amplicon size
OCT4 Forward: GAGTGAGAGGCAACCTGGAG; reverse: GTGAAGTGAGGGCTCCCATA 274
NANOG Forward: GAATAACCCGAATTGGAGCAG; reverse: AGCGATTCCTCTTCACACAGTTG 141
SOX2 Forward: AGTCTCCAAGCGACGAAAAA; reverse: GCAAGAAGCCTCTCCTTGAA 142



2.9. Microbiological control of AD-MSCs and reagents

MSCs were tested for a putative contamination during the steps of production. These quality controls included tests for the following: (i) bacteria and fungi detection – samples are inoculated into liquid and solid specific media; (ii) mycoplasma detection – culture in solid and liquid media, indirect DNA staining (Hoechst 33258) and PCR; and (iii) viruses detection – a panel of tests to detect pathogens, endogenous and adventitious viruses (culture in permissive monolayer cultured cells, PCR, real-time PCR, haemoagglutination, ELISA, sieroneutralization, electronic microscopy and immunoenzymatic tests).

2.10. Tumorigenic control of AD-MSCs

Tumorigenic control of AD-MSCs was assessed in vitro and in vivo. The AD-MSCs, the cell line VERO (negative control) and the cell line Hep-2 (positive control) were cultured in vitro into three different flasks. Later, each cell culture was inoculated in 6-well plates, which contained the solid medium, and incubated at 37°C. They were observed by microscopy for 3 weeks. After 7–10 days, the tumorigenic cells started to replicate, producing multicellular agglomerates. The negative cells showed atrophy.

AD-MSCs, VERO cells and Hep-2 cells were inoculated in vivo by intracutaneous or intramuscular injection each in groups of 10 mice lacking the thymus gland (genotype Nu/Nu). Any new formation of nodules in the injected area was regularly checked. Neoplasia was measured to assess growth. The test was considered valid if at least 9 mice inoculated with the control positive cells (Hep-2) produced neoplasia.

2.11. PRP preparation

Since the stem cells were about to be inoculated into dogs with OA using PRP as scaffolds, whole blood (20 ml) was collected in vacutainer tubes containing 3.8% sodium citrate. PRP was obtained by centrifuging the blood at 180 g for 10 min. The upper two-thirds of the PRP was carefully removed with a plastic transfer pipette, and transferred into plastic containers to measure the platelet concentration. It was then centrifuged at 1200 g for 10 min to separate CP (platelet concentrate) from PPP (platelet-poor plasma). CP was resuspended in an adequate volume of PPP to obtain a final platelet concentration of 1×109 platelets/ml.

All the haemocomponent production phases were performed in a sterile environment within a hazard cabinet.

2.12. Clinical evaluation and treatment

Before implanting the AD-MSCs, OA was clinically evaluated (the site, size and severity of the injury) in otherwise healthy dogs. The animals showed gait changes characteristic of OA, including persistent lameness at a walk and trot, pain on passive manipulation of the affected joint(s), limited range of motion with pain at less than full range of passive motion and functional disabilities as measured by willingness to walk and run. Each qualified case had radiographic evidence of DJD (mild degenerative change; occasional osteophytes), certified by a veterinarian.

AD-MSCs were isolated from a minimum of 5 g of adipose tissue collected from each dog by the veterinarian. Each dog received 3–5 million viable autochthonous cells. The amount of cells to be implanted depended on the extent of the lesion or the surface to be treated. The cells were implanted with PRP in 2 dogs and with hyaluronic acid (HYALGAN 20 mg/2 ml; Fidia) in the others. After being anaesthetized with mededomidine (0.1 ml/kg body weight), the cells were injected into single aseptically prepared sites on the elbow joint.

3. Results

AD-MSCs successfully isolated from subcutaneous or visceral fat of the dogs became semi-confluent in 25 cm2 flasks in 5–6 days. Fibroblast-like cells seen in primary culture maintain this phenotype and grew out in culture (Figure 1).

3.1. CFUs

Cells isolated from subcutaneous or visceral fat were similar in their ability to form colonies on a plastic surface in DMEM Low Glucose with 5% FBS (Figure 2).

3.2. Differentiation of AD-MSCs

Cells from both subcutaneous and visceral fat were also equal in terms of differentiation potential across all the 3 lineages tested of the stained specimens.

3.3. Osteogenesis

Upon induction with NH OsteoDiff Medium, the cells became more cuboidal-like in phenotype, continued to proliferate actively and formed cell aggregates that would roll into a sheet and be easily detached (Figure 3a). Deposition of calcified extracellular matrix was evident in treated cells that formed aggregates (Figure 3b), but not in monolayer cells seen after von Kossa staining (Figures 3c–3d). The phenotype did not change in untreated cells.

3.4. Chondrogenesis

One day after the seeding in micromass culture of the AD-MSCs, three-dimensional aggregates were observed in tubes treated with NH Chondro Diff Medium (Figure 4a), but not in control tubes (Figure 4b). Treated micromasses stained positive for Alcian Blue, indicating the presence of sulfated proteoglycans, confirmed by staining paraffin-embedded sections.

3.5. Adipogenesis

Fat globules staining positive with Oil Red O were noted within 4–5 days of treatment with differentiation medium (Figure 5a), which continued to increase in size (Figure 5b). No differentiation was observed in the untreated cells (Figures 5c–5d).

3.6. Expression of stemness markers

RT–PCR analysis showed that AD-MSCs express the following pluripotency-associated transcription factors: OCT4, NANOG and SOX2 (Figure 6).

3.7. Quality controls

Microbiological quality controls performed on cells and PRP ensured their safety. Tumorigenicity assays performed on cells were negative. Cells were also cryopreserved for possible further treatments, studies and allogeneic implantations.

3.8. Clinical evaluation and treatment

During the first week of treatment, the dogs were kept at rest. After 1 week, each dog was examined by skilled veterinarians. Clinical outcomes improved markedly after therapy compared with the baseline. After 1 month, all the dogs, whether given cells in PRP or hyaluronic acid, showed functional improvements in their disability, lameness at trot and pain on manipulation of the joints. Owner-assessed outcomes confirmed the improvements.

4. Discussion

Regenerative medicine is a new interdisciplinary sector aimed at repairing, replacing and regenerating damaged tissues and organs through the use of cells manipulated ex vivo. In fact, the present study demonstrated that the MSCs, a population of pluripotent cell precursors used in regenerative medicine, cultured and expanded in laboratories, can be readily isolated from adipose tissue of the mature dog. Moreover, their ability to form colony and differentiate into a variety of cell phenotypes has been established (Owen, 1988; Owen and Friedenstein, 1988). Our AD-MSCs expressed OCT4, NANOG and SOX2 at mRNA level, pluripotency markers usually ascribed to embryonic stem cells. These results indicated the stemness of the cells isolated from canine fat, despite their expression being documented in some of the somatic stem cells (Izadpanah et al., 2005; Kucia et al., 2006). Since the results of quality controls ensured the availability of AD-MSCs for clinical and experimental use, the 4 treated dogs showed functional improvement in their locomotor system as assessed by skilled veterinarians. Follow-up studies indicated that OA of the elbow joints improved with time, probably due to host MSC mobilization in response to inflammation and target-specific tissue via active mechanisms (Karp and Leng Teo, 2009), which are known to secrete cytokines and growth factors that can stimulate recovery in a paracrine manner (Caplan and Dennis, 2006; Gimble et al., 2007; Ortiz et al., 2007). In particular, AD-MSCs repaired tissue by multiple interactions that included secretion of paracrine factors to enhance regeneration of injured cells, and stimulation of proliferation and differentiation of the stem-like progenitor cells found in most tissue to decrease inflammatory reactions (Bernardo et al., 2009; Block et al., 2009). Considering that OA is associated with the loss of homoeostasis in joint tissues, particularly in articular cartilage, an insufficient repair response that results from a reduction in cell number and the loss of phenotypic stability is an important contributor to disease progression. Dogs with OA of the humeroradial joints treated with intra-articular injection of AD-MSCs showed a significant improvement compared with those given drug therapy. In conclusion, the data indicate that cellular therapy has a significant potential for clinical use in the treatment of lameness associated with OA due to convenient isolation and differentiation into appropriate tissue-specific cell types (Toma et al., 2002; Sasaki et al., 2008), but it is best for the treatment to begin before an injury becomes severe.

Author contribution

Annalisa Guercio carried out the design of the study and co-ordinated the study. Patrizia Di Marco carried out the clinical evaluation. Stefania Casella participated in the design of the study, and also helped to shape and draft the paper. Vincenza Cannella and Giuseppa Purpari participated in the design of the study. Laura Russotto and Santina Di Bella carried out the experimental trial. Giuseppe Piccione carried out the design of the study and performed the statistical analysis. All authors, in agreement with the content of the paper, have contributed significantly.

Funding

This work was supported by the research “Adult mesenchymal stem cells: differentiative lineages and applications in autologous and allogenic implantation and tissue remodeling” [grant number IZS SI 2007 RF] in part by funding from the Istituto Zooprofilattico Sperimentale della Sicilia and co-funding by the Italian Ministry of Health.

REFERENCES

Bernardo, ME, Locatelli, F and Fibbe, WE (2009) Mesenchymal stromal cells. A novel treatment modality for tissue repair. Hematopoietic Stem Cells VII. Ann N Y Acad Sci 1176, 101-17
Crossref   Medline   1st Citation  

Black, LL, Gaynor, J, Gahring, D, Adams, C, Aron, D and Harman, S (2007) Effect of adipose-derived mesenchymal stem and regenerative cells on lameness in dogs with chronic osteoarthritis of the coxofemoral joints: a randomized, double-blinded, multicenter, controlled trial. Vet Ther 8, 272-84
Medline   1st Citation   2nd  

Black, LL, Gaynor, J, Adams, C, Dhupa, S, Sams, AE and Taylor, R (2008) Effect of intraarticular injection of autologous adipose-derived mesenchymal stem and regenerative cells on clinical signs of chronic osteoarthritis of the elbow joint in dogs. Vet Ther 9, 192-200
Medline   1st Citation  

Block, GJ, Ohkouchi, S, Fung, F, frankel, J, Gregory, C and Pochampally, R (2009) Multipotent stromal cell are activated to reduce apoptosis in part by upregulation and secretion of stanniocalcin-1. Stem Cells 27, 670-81
Medline   1st Citation  

Campagnoli, C, Roberts, IA, Kumar, S, Bennett, PR, Bellantuono, I and Fisk, NM (2001) Identification of mesenchymal stem/progenitor cells in human first-trimester fetal blood, liver, and bone marrow. Blood 98, 2396-402
Crossref   Medline   1st Citation  

Caplan, AI and Dennis, JM (2006) Mesenchymal stem cells as trophic mediators. J Cell Biochem 98, 1076-84
Crossref   Medline   1st Citation   2nd  

Carrancio, S, López-Holgado, N, Sánchez-Guijo, FM, Villarón, E, Barbado, V and Tabera, S (2008) Optimization of mesenchymal stem cell expansion procedures by cell separation and culture conditions modification. Exp Hematol 36, 1014-21
Crossref   Medline   1st Citation  

Chen, Y, Xiang, LX, Shao, JZ, Pan, RL, Wang, YX, Dong, XJ and Zhang, GR (2010) Recruitment of endogenous bone marrow mesenchymal stem cells towards injured liver. J Cell Mol Med 14, 1494-508
Crossref   Medline   1st Citation  

Crovace, A, Favia, A, Lacitignola, L, Di Comite, MS, Staffieri, F and Francioso, E (2008) Use of autologous bone marrow mononclear cells and cultured marrow stromal cells in dogs with orthopaedic lesions. Vet Res Commun 32, 35-8
Crossref   Medline   1st Citation  

Erices, A, Conget, P and Minguell, JJ (2000) Mesenchymal progenitor cells in human umbilical cord blood. Br J Haematol 109, 235-42
Crossref   Medline   1st Citation  

Fraser, JK, Wulur, I, Alfonso, Z and Hedrick, MH (2006) Fat tissue: an underappreciated source of stem cells for biotechnology. Trends Biotech 4, 150-4
1st Citation  

Friedenstein, AJ, Petrakova, KV, Kurolesova, AI and Frolova, GP (1968) Heterotopic of bone marrow. Analysis of precursor cells for osteogenic and hematopoietic tissues. Transplantation 6, 230-47
Crossref   Medline   1st Citation  

Gimble, J, Katz, A and Bunnel, A (2007) Adipose-derived stem cells for regenerative medicine. Circ Res 100, 1249
Crossref   Medline   1st Citation   2nd   3rd  

Izadpanah, R, Joswig, T, Tsien, F, Dufour, J, Kirijan, JC and Bunnell, BA (2005) Characterization of multipotent mesenchymal stem cells from the bone marrow of rhesus macaques. Stem Cells Dev 14, 440-51
Crossref   Medline   1st Citation  

Johnson, SA and Budsberg, SC (1997) Nonsteroidal anti-inflammatory drugs and corticosteroid for the management of canine osteoarthritis. Vet Clin North Am Small Anim Pract 27, 841-62
Medline   1st Citation  

Karp, JM and Leng Teo, GSL (2009) Mesenchymal stem cell homing: the devil is in the details. Cell Stem Cell 4, 201-16
1st Citation  

Kucia, M, Reca, R, Campbell, FR, Zuba-Surma, E, Majka, M and Ratajczack, J (2006) A population of very small embryonic-like (VSEL) CXCR4(+)SSEA-1(+)Oct-4+stem cells identified in adult bone marrow. Leukemia 20, 857-69
Crossref   Medline   1st Citation  

Luyten, FP (2004) Mesenchymal stem cells in osteoarthritis. Curr Opin Rheumatol 16, 599-603
Crossref   Medline   1st Citation  

Minguell, JJ, Erices, A and Conget, P (2001) Mesencymal stem cells. Exp Biol Med 226, 507-20
1st Citation  

Mortellaro, CM (2003) Pathophysiology of osteoarthritis. Vet Res Commun 27, 75-8
Crossref   Medline   1st Citation  

Neupane, M, Chang, CC, Kiupel, M and Yuzbasiyan-Gurkan, V (2008) Isolation and characterization of canine adipose-derived mesenchymal stem cells. Tissue Eng 14, 1007-15
Crossref   1st Citation  

Owen, M (1988) Marrow stromal stem cells. J Cell Sci 10, 63-76
1st Citation  

Owen, M and Friedenstein, AJ (1988) Stromal stem cells: marrow-derived osteogenic precursors. Ciba Found Symp 136, 42-60
Medline   1st Citation  

Ortiz, LA, Du Treil M; Fattman, C, Pandey, AC, Torres, G, Go, K and Phinney, DG (2007) Interleukin 1 receptor antagonist mediates the anti-inflammatory and antifibrotic effect of mesenchymal stem cell during lung injury. Proc Natl Acad Sci USA 104, 11002-7
Crossref   Medline   1st Citation  

Parker, A and Katz, A (2006) Adipose-derived stem cells for the regeneration of damaged tissues. Expert Opin Biol Ther 6, 567-78
Crossref   Medline   1st Citation   2nd  

Sasaki, M, Abe, R, Fujta, Y, Ando, S, Inokuma, S and Shimizu, H (2008) Mesenchymal stem cell are recruited into wounded skin and contribute to wound repair by transdifferentation into multiple skin cell type. J Immunol 180, 2581-7
Medline   1st Citation  

Schaffler, A and Buchler, C (2007) Concise review: adipose tissue-derived stem cells, basic and clinical implication. Stem Cells 25, 818-27
Crossref   Medline   1st Citation   2nd  

Toma, C, Pittenger, MF, Cahill, KS, Byrne, BJ and Kessier, PD (2002) Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 105, 93-8
Crossref   Medline   1st Citation  

Tonchev, AB, Bełtowski, J, Fiore, M, RanČić, G, Chechi-Kostova, K and Bojanić, V (2010) Adipobiology of stem cell-based therapy: secretome insight. Biomed Rev 21, 57-63
1st Citation   2nd  

Vasseur, P, Johnson, A, Budsberg, S, Lincoln, JD, Toombs, JP and Whitehair, JG (1995) Randomized, controlled trial of the efficacy of carprofen, a non-steroidal anti-inflammatory drug, in the treatment of osteoarthritis in dogs. J Am Vet Med Assoc 206, 807-11
Medline   1st Citation  


Received 25 May 2011/20 July 2011; accepted 22 September 2011

Published as Cell Biology International Immediate Publication 22 September 2011, doi:10.1042/CBI20110304


© The Author(s) Journal compilation © 2012 Portland Press Limited


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)