Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2012) 36, 491–495 (Printed in Great Britain)
Effect of all-trans-retinoic acid on the expression of primordial germ cell differentiation-associated genes in mESC-derived EBs
Xin Guo, Zheng‑Yu Qi, Yan‑Min Zhang, Jie Qin, Guang‑Hui Cui, Yao‑Ting Gui and Zhi‑Ming Cai1
Guangdong Key Laboratory of Male Reproductive Medicine and Genetics, Peking University Shenzhen Hospital, The Institute of Urology, Shenzhen PKUHKUST Medical Center, Shenzhen 518036, Peoples Republic of China


atRA (all-trans-retinoic acid) is known to induce the differentiation of mESCs (mouse embryonic stem cells) into PGCs (primordial germ cells) in vitro. However, it is not clear as to what changes occur in PGC differentiation-associated genes or what mechanisms are involved when EBs (embryoid bodies) derived from mESCs are induced by atRA. EBs derived from mESCs were treated with 1, 2 or 5 μM atRA for 16 h, 2 days or 5 days. Real-time PCR and Western blot analysis were performed to detect the relative levels of PGC differentiation-associated genes (Lin28, Blimp1, Stra8 and Mvh) and the corresponding proteins respectively. Immunofluorescence was used to detect the protein location and distribution in EBs. The expression characteristics of genes could be divided into three categories: rapidly reached the peak value in 16 h and then decreased (Stra8, Lin28), initially low and then increased to reach the peak value in 5 days (Mvh) and relatively unchanged (Blimp1). A low level of Lin28 was expressed in EBs treated with atRA for 2 days or 5 days. The variation in the level of Lin28 mRNA did not influence the change in the level of Blimp1 mRNA. The changes in Stra8/Lin28 were consistent with the corresponding changes in the levels of their respective mRNAs, but the changes for Mvh/Blimp1 were not consistent with the corresponding changes in the levels of their respective mRNAs. Blimp1 expression may be independent of the effect of atRA on PGC differentiation. atRA may promote the start of a period in which there is a low level of Lin28 expression during PGC differentiation.


Key words: all-trans-retinoic acid, embryoid body, mouse embryonic stem cell, primordial germ cell, retinoic acid

Abbreviations: atRA, all-trans-retinoic acid, EB, embryoid body, GAPDH, glyceraldehyde-3-phosphate dehydrogenase, MEF, mouse embryonic fibroblast, mESC, mouse embryonic stem cell, PGC, primordial germ cell, RA, retinoic acid

1To whom correspondence should be addressed (email caizhiming2000@yahoo.com.cn).


1. Introduction

When treated with atRA (all-trans-retinoic acid), mESCs (mouse embryonic stem cells) can differentiate into PGCs (primordial germ cells) and SSCs (spermatogenic stem cells) in vitro (Geijsen et al., 2004; Nayernia et al., 2006). Although germ cells can be obtained from mESCs, the regulatory mechanisms induced by atRA and the changes in the expression levels of PGC differentiation-associated genes in mESCs treated with atRA remain unclear.

The natural metabolites of RA (retinoic acid) are atRA and 9-cis-RA (Soprano et al., 2007). atRA plays an important role in mediating growth and differentiation of both normal and transformed cells. It is widely used for stem cell differentiation; for example, 10−7–10−8 M atRA is optimal for the induction of neurogenesis, 10−9 M atRA induces cardiac and vascular smooth muscle differentiation, and 10−6 M atRA is used principally to induce germ cell differentiation (Okada et al., 2004; Kennedy et al., 2009; Silva et al., 2009; Kawaguchi et al., 2010; Lin et al., 2010).

Changes in the expression levels of stem cell differentiation-associated genes after atRA treatment display three phases, the initial primary response phase (0–16 h following atRA treatment), the committed differentiation phase (16 h to 2 days) and the terminal differentiation phase (5–6 days) (Micallef et al., 2005; Salero and Hatten, 2007). In the present study, four typical genes, Lin28, Blimp1, Mvh and Stra8, were selected because these genes play important roles in the differentiation of mESCs into PGCs (Toyooka et al., 2003; Geijsen et al., 2004; Nayernia et al., 2006; West et al., 2009). Notably, Lin28 is a novel upstream regulator of PGC development related to Blimp1 (West et al., 2009). We have investigated the expression characteristics of these four genes in the mESC-derived EBs (embryoid bodies) induced by atRA for 16 h, 2 days or 5 days.

2. Materials and methods

2.1. mESC and EB cultures

MEFs (mouse embryonic fibroblasts) treated with mitomycin served as feeder layers to maintain cultures of ES-D3 cells (CRL-1394, A.T.C.C.) in ESC medium. For EB differentiation, ES cells were digested and collected in LIF (leukaemia inhibitor factor)-free EB medium containing 20% Knockout™ serum replacement (Invitrogen) instead of FBS (fetal bovine serum), plated in the gelatin-coated dishes and incubated at 37°C for 45 min to remove the MEFs. Non-adherent cells were collected and plated in hanging drops with 400 cells per 20 μl droplet in an inverted bacterial Petri dish (BD Franklin Lakes). EBs were collected from the hanging drops at day 3 and transferred into 10 cm Petri dishes. They were exposed to daily treatments with 1, 2 or 5 μM atRA (Sigma) dissolved in ethanol for 16 h, 2 days or 5 days. Control cells were treated with an equal volume of ethanol.

2.2. Reverse transcription and quantitative real-time PCR

Total RNA was extracted and quantified from the mESC-derived EBs using TRIzol® reagent (Invitrogen). One microgram of RNA was used for cDNA synthesis using random primers (Invitrogen) under standard conditions (see Table 1). A Platinum® SYBR® Green qPCR SuperMix UDG (Invitrogen) kit was utilized. The qPCR cycling included 50 cycles of 15 s denaturation at 95°C, 40 s annealing at 55°C and 30 s elongation at 72°C. The GAPDH (glyceraldehyde-3-phosphate dehydrogenase) housekeeping gene was used to normalize all samples. Experiments were carried out in triplicate. The normalized abundance of each transcript was log transformed to equalize the estimated variances.


Table 1 Primer sequences for quantitative real-time PCR

Gene Forward primer (5′→3′) Reverse primer (5′→3′)
Lin28 AGGCGGTGGAGTTCACCTTTAAGA AGCTTGCATTCCTTGGCATGATGG
Blimp1 AGCATGACCTGACATTGACACC CTCAACACTCTCATGTAAGAGGC
Stra8 TGCCGCCATCTCCCACCTGT CTGTCCACGCCGCTGTCCTTC
Mvh CACCGGCAATTTTGACTTTT GTTTGAGCACAAGCCATCAA
GAPDH CGACTTCAACAGCAACTC GTAGCCGTATTCATTGTCAT



2.3. Western blot analysis

The ProteoJET™ Mammalian Cell Lysis Reagent (MBI Fermentas) was used to extract proteins from 10-week-old mouse testes and hearts to serve as positive and negative controls respectively. Mvh (76 kDa, ab13840, Abcam), Stra8 (45 kDa, ab49602, Abcam), Lin28 (29 kDa, ab46020, Abcam) and Blimp1 (98 kDa, ab81962, Abcam) were detected. The blots were visualized with SuperSignal® West HisProbe™ kit (Pierce).

2.4. Immunofluorescence detection of proteins

EBs were collected by centrifugation and fixed in 4% paraformaldehyde for 30 min at room temperature and dehydrated with alcohol. Ultimately, EB pellets were embedded in paraffin, and 3 μm serial sections were cut on a microtome. EB slides were deparaffinized with xylene and rehydrated in a series of ethanol washes. Primary antibodies, including those against Mvh (0.01 mg/ml) and Stra8 (0.01 mg/ml) were used. The secondary antibody was goat anti-mouse IgG/Cy3 (Millipore). The slides were mounted for analysis.

2.5. Statistical analysis

Data were subjected to one-way ANOVA and Tukey–Kramer's multiple comparison tests. Statistically significant differences between the experimental groups are indicated by different letters (P<0.05), whereas the lack of a significant difference is indicated with the same letter (P>0.05) (Silva et al., 2009).

3. Results

3.1. Morphological changes of mESC-derived EBs induced with atRA

EBs were maintained in suspension for 3 days, and exposed to atRA for 16 h, 2 days or 5 days. Control group EBs were only treated with ethanol; therefore, these EBs were maintained in culture for 4 days (Figure 1D), 5 days (Figure 1H) or 8 days (Figure 1L). When EBs were treated with atRA for 16 h or 2 days, logy of EBs was unchanged (Figures 1A–1C and Figures 1E–1G), but they became more mature when treated with atRA for 5 days (Figures 1I–1K). However, their morphology was not noticeably changed from that of the corresponding control group (Figure 1L).

3.2. Characteristics of PGC differentiation-associated genes in EBs treated with atRA

Stra8 is an atRA primary response gene (Oulad-Abdelghani et al., 1996). The expression features of the studied genes could be divided into three categories by qPCR (Figure 2; 1), and rapidly reached a peak value in 16 h and then decreased (Stra8 and Lin28), Figure 2; 2) initially low and then increased to reach the peak value in 5 days (Mvh) or (Figure 2; 3) relatively unchanged (Blimp1). Overall, the amount of Lin28 mRNA was decreased when EBs were treated with atRA for an extended time. Notably, the mRNA abundance of Mvh was gradually increased when EBs were treated with 1 μM atRA, but the level of this mRNA was unchanged when EBs were treated with 2 or 5 μM atRA. We also observed that a low level of Lin28 was expressed in undifferentiated mESCs, but a relatively high level in EBs in the control groups.

3.3. Western blot analysis in EBs treated with atRA

Mvh, Stra8, Lin28 and Blimp1 were analysed at the protein level (Figure 3). The expression levels of Stra8, Mvh and Lin28 were higher in the group of EBs treated with atRA for 16 h than for 5 days. The expression changes for Stra8/Lin28 were consistent with those in the levels of their corresponding mRNAs, but the level of Mvh protein varied inversely with the level of its mRNA. The change in the level of Blimp1 was greater in the group treated with atRA for 5 days than those treated for 16 h. In addition, this variation in the level of Blimp1 was not consistent with its mRNA expression.

3.4. Mvh and Stra8 staining of atRA-treated EBs

Mvh is a specific marker of germ cell formation, and Stra8 is a marker of cells entering in meiosis. The putative PGCs were detected and located in EBs by immunofluorescence staining of Mvh and Stra8 (Figure 4). The positive EBs cells that had a punctuate cytoplasmic distribution indicated putative PGCs. Mouse testis was served as a positive control, and Mvh/Stra8-positive cells in the seminiferous tubules were spermatogenic cells, but not Sertoli, cells in these tissues.

4. Discussion

atRA induces differentiation of mESCs into PGCs and promotes the proliferation/survival of mouse PGCs in vitro (Koshimizu et al., 1995; Geijsen et al., 2004). mESC-derived EBs, but not mESCs, serve as the first step in PGC differentiation because EB formation simulates the process of mouse germ cell development in vivo. We found EBs not significantly different in morphology when treated with atRA. Thus differentiation, but not proliferation, may occur in the fractional cells within EBs, as demonstrated by the change in gene expression.

The mRNA abundance of Mvh gradually increased when EBs were treated with 1 μM atRA. Mvh is a characteristic atRA secondary response gene associated with a specific differentiation pathway (Bowles and Koopman, 2007; Soprano et al., 2007). Blimp1 is a key regulator of germ cell commitment (Ohinata et al., 2005; Vincent et al., 2005). Blimp1 mRNA produced no obvious change when EBs were treated with atRA. Therefore, we think that Blimp1 expression is independent of the effect of atRA on PGC differentiation or that it is regulated by the other factors, such as Lin28. Lin28 is a novel upstream regulator of PGC development related to Blimp1, potentially acts via repression of the let-7 miRNA (microRNA) family within PGCs or their precursors, and then promotes PGC specification (Viswanathan et al., 2008; West et al., 2009; Peng et al., 2011). In vitro, 4 days EBs mimic the E7.25 in vivo; however, the E7.25 PGCs express high level of Lin28 (West et al., 2009). Our experiments show that EBs treated with atRA for 16 h are equivalent to the suspended 4 days EBs (those treated with atRA after culture for 3 days), which express a relative high level of Lin28. Some cells within EBs treated with atRA for 16 h have differentiated into PGCs and express Lin28. We also observed that EBs treated with atRA for 2 or 5 days are equivalent to suspended 5 or 8 days EBs, which express low levels of Lin28. Interestingly, West et al. (2009) have shown that the 9-day EBs persistently express a low level of Lin28, and Lin28-negative PGCs become apparent at this time. Therefore, we speculate that atRA may promote the start of a period in which there is a low level of Lin28 expression during PGC differentiation.

The variation in the level of Lin28 mRNA did not notably influence the change in the level of Blimp1 mRNA. At the protein level, however, a decreasing trend for Lin28 and an increasing tendency for Blimp1 were found. The post-transcriptional regulation of Blimp1 expression by let-7 is under the control of Lin28 (Nie et al., 2008). Although the reason was not investigated, these results to some extent indicate that mRNA abundance is changed, and the corresponding protein levels are also altered when EBs have been treated with atRA for some time. Immunofluorescence localization further verified this and indicated that Mvh+/Stra8+ putative PGCs exist in EBs.

The process of the differentiation of mESCs into germ cells in vitro is significantly accelerated relative to in vivo development. Our results show that changes in the expression levels of PGC differentiation-associated genes are achieved within a short time (16 h to 5 days) when EBs are treated with atRA. The data may provide some explanation for the accelerated development in vitro.

Author contribution

The amount that authors contributed to this paper was in the following order (most to least): Xin Guo, Zheng-Yu Qi, Yan-Min Zhang, Jie Qin, Guang-Hui Cui and Yao-Ting Gui. Zhi-Ming Cai is the corresponding author.

Funding

This work was supported by the National Natural Science Foundation of China [grant numbers 30500543, 30700824 and 30972992, 81100471], Medical Research Fund of Guangdong Province [grant number B2009230], Specialized Research Fund for the Doctoral Program of Higher Education from Ministry of Education of China [grant number 20090001120130], Shenzhen Municipal R & D funding for basic research programs funded project [grant number JC201005260214A] and the Science and Technology Plan Key Projects of Shenzhen [grant number 201001014].

REFERENCES

Bowles, J and Koopman, P (2007) Retinoic acid, meiosis and germ cell fate in mammals. Development 134, 3401-11
Crossref   Medline   1st Citation  

Geijsen, N, Horoschak, M, Kim, K, Gribnau, J, Eggan, K and Daley, GQ (2004) Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature 427, 148-54
Crossref   Medline   1st Citation   2nd   3rd  

Kawaguchi, J, Nichols, J, Gierl, MS, Faial, T and Smith, A (2010) Isolation and propagation of enteric neural crest progenitor cells from mouse embryonic stem cells and embryos. Development 137, 693-704
Crossref   Medline   1st Citation  

Kennedy, KA, Porter, T, Mehta, V, Ryan, SD, Price, F and Peshdary, V (2009) Retinoic acid enhances skeletal muscle progenitor formation and bypasses inhibition by bone morphogenetic protein 4 but not dominant negative beta-catenin. BMC Biol 7, 67
Crossref   Medline   1st Citation  

Koshimizu, U, Watanabe, M and Nakatsuji, N (1995) Retinoic acid is a potent growth activator of mouse primordial germ cells in vitro. Dev Biol 168, 683-5
Crossref   Medline   1st Citation  

Lin, SC, Dollé, P, Ryckebüsch, L, Noseda, M, Zaffran, S, Schneider, MD and Niederreither, K (2010) Endogenous retinoic acid regulates cardiac progenitor differentiation. Proc Natl Acad Sci USA 107, 9234-9
Crossref   Medline   1st Citation  

Micallef, SJ, Janes, ME, Knezevic, K, Davis, RP, Elefanty, AG and Stanley, EG (2005) Retinoic acid induces Pdx1-positive endoderm in differentiating mouse embryonic stem cells. Diabetes 54, 301-5
Crossref   Medline   1st Citation  

Nayernia, K, Nolte, J, Michelmann, HW, Lee, JH, Rathsack, K and Drusenheimer, N (2006) In vitro-differentiated embryonic stem cells give rise to male gametes that can generate offspring mice. Dev Cell 11, 125-32
Crossref   Medline   1st Citation   2nd  

Nie, K, Gomez, M, Landgraf, P, Garcia, JF, Liu, Y and Tan, LH (2008) MicroRNA-mediated down-regulation of PRDM1/Blimp-1 in Hodgkin/Reed-Sternberg cells: a potential pathogenetic lesion in Hodgkin lymphomas. Am J Pathol 173, 242-52
Crossref   Medline   1st Citation  

Ohinata, Y, Payer, B, O'Carroll, D, Ancelin, K, Ono, Y and Sano, M (2005) Blimp1 is a critical determinant of the germ cell lineage in mice. Nature 436, 207-13
Crossref   Medline   1st Citation  

Okada, Y, Shimazaki, T, Sobue, G and Okano, H (2004) Retinoic-acid-concentration-dependent acquisition of neural cell identity during in vitro differentiation of mouse embryonic stem cells. Dev Biol 275, 124-42
Crossref   Medline   1st Citation  

Oulad-Abdelghani, M, Bouillet, P, Décimo, D, Gansmuller, A, Heyberger, S and Dollé, P (1996) Characterization of a premeiotic germ cell-specific cytoplasmic protein encoded by Stra8, a novel retinoic acid-responsive gene. J Cell Biol 135, 469-77
Crossref   Medline   1st Citation  

Peng, S, Chen, LL, Lei, XX, Yang, L, Lin, H, Carmichael, GG and Huang, Y (2011) Genome-wide studies reveal that Lin28 enhances the translation of genes important for growth and survival of human embryonic stem cells. Stem Cells 29, 496-504
Crossref   Medline   1st Citation  

Salero, E and Hatten, ME (2007) Differentiation of ES cells into cerebellar neurons. Proc Natl Acad Sci USA 104, 2997-3002
Crossref   Medline   1st Citation  

Silva, C, Wood, JR, Salvador, L, Zhang, Z, Kostetskii, I, Williams, CJ and Strauss, JF (2009) Expression profile of male germ cell-associated genes in mouse embryonic stem cell cultures treated with all-trans retinoic acid and testosterone. Mol Reprod Dev 76, 11-21
Crossref   Medline   1st Citation   2nd  

Soprano, DR, Teets, BW and Soprano, KJ (2007) Role of retinoic acid in the differentiation of embryonal carcinoma and embryonic stem cells. Vitam Horm 75, 69-95
Medline   1st Citation   2nd  

Toyooka, Y, Tsunekawa, N, Akasu, R and Noce, T (2003) Embryonic stem cells can form germ cells in vitro. Proc Natl Acad Sci USA 100, 11457-62
Crossref   Medline   1st Citation  

Vincent, SD, Dunn, NR, Sciammas, R, Shapiro-Shalef, M, Davis, MM and Calame, K (2005) The zinc finger transcriptional repressor Blimp1/Prdm1 is dispensable for early axis formation but is required for specification of primordial germ cells in the mouse. Development 132, 1315-25
Crossref   Medline   1st Citation  

Viswanathan, SR, Daley, GQ and Gregory, RI (2008) Selective blockade of microRNA processing by Lin28. Science 320, 97-100
Crossref   Medline   1st Citation  

West, JA, Viswanathan, SR, Yabuuchi, A, Cunniff, K, Takeuchi, A and Park, IH (2009) A role for Lin28 in primordial germ-cell development and germ-cell malignancy. Nature 460, 909-13
Medline   1st Citation   2nd   3rd   4th   5th  


Received 5 August 2011/23 November 2011; accepted 17 January 2012

Published as Cell Biology International Immediate Publication 17 January 2012, doi:10.1042/CBI20110423


© The Author(s) Journal compilation © 2012 International Federation for Cell Biology


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)