Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2012) 36, 519–527 (Printed in Great Britain)
Establishment of ultra long-lived cell lines by transfection of TERT into normal human fibroblast TIG-1 and their characterization
Mizuna Kamada, Tsutomu Kumazaki, Taira Matsuo, Youji Mitsui and Tomoko Takahashi1
Laboratory of Physiological Chemistry, Faculty of Pharmaceutical Sciences at Kagawa, Tokushima Bunri University, 13141 Shido, Sanuki, Kagawa, 7692193, Japan


To establish useful human normal cell lines, TERT (telomerase reverse transcriptase) cDNA was transfected into normal female lung fibroblast, TIG-1. After long-term-sub-cultivation of 74 individual clones selected for resistance to G418, we obtained 55 cultures with normal range of life span [75 PDL (population doubling level)], 16 cultures with extended life span (75–140 PDL). In addition, 3 immortal cell strains and unexpectedly, one ultra long-lived cell line (ULT-1) with life span of 166 PDL were established. IMT-1, one of the immortal cell strains was confirmed to maintain long telomere length, high telomerase activity and an extremely low level of p16INK4A. They also showed moderate p53 and p21CIP1 expression, keeping vigorous growth rate even at 450 PDL. High level of fibronectin and collagen 1α expression confirmed IMT-1 as normal fibroblasts, although one X chromosome had been lost. ULT-1, however, kept a near normal karyotypes and had shortening of telomere length, high expression of p16INK4A, moderate levels of senescence associated-β-galactosidase positive cells and decreased growth rate only after 150 PDs (population doublings), and finally reached senescence at 166 PDL with morphology of normal senescent fibroblasts. As resources of standard normal human cell, abundant vials of early and middle passages of ULT-1 have been stocked. The use of the cell line is discussed, focusing on isograft of artificial skin and screening of anti-aging or safe chemical agents.


Key words: cell transplantation, immortal cell strains, non-tumorigenic, replicative senescence, telomere

Abbreviations: FBS, fetal bovine serum, GAPDH, glyceraldehyde-3-phosphate dehydrogenase, HRP, horseradish peroxidase, PD, population doubling, PDL, population doubling level, RT–PCR, reverse transcription PCR, SA-β-Gal, senescence associated-β-galactosidase, SCID, severe combined immune-deficient, TERT, telomerase reverse transcriptase, TRF, telomere restriction fragment

1To whom correspondence should be addressed (email t-takahashi@kph.bunri-u.ac.jp).


1. Introduction

Human normal somatic cells have a limited division potential and have not been spontaneously immortalized in vitro, unlike mouse-derived normal somatic cells (Hayflick and Moorhead, 1961). Human tissue stem cells, such as haematopoietic stem cells, have some telomerase activity (Broccoli et al., 1995; Hiyama et al., 1995) and have been used for transplantation to patients (Cutler and Antin, 2001; Nivison-Smith et al., 2005; Gratwohl et al., 2010). Telomerase activity, however, was too low to expand enough number of blood cells for therapy in vivo and in vitro (Notaro et al., 1997; Yui et al., 1998).

Introduction of human telomerase catalytic subunit gene [TERT (telomerase reverse transcriptase)] into human normal fibroblasts and vascular endothelial cells has produced immortal cell strains at very low frequency (Kumazaki et al., 2004; Hiyama et al., 2005; Anno et al., 2007; see also Kiyono et al., 1998; Dickson et al., 2000). Immortalization of human cells is seen as a pre-stage of cancerization (Kumamoto et al., 2001) and therefore transplantation of immortal cells into patients was supposed to be risky because of tumour generation. However, ectopic expression of TERT in normal human cells does not necessarily evoke their immortalization, nor produce malignant transformants (Hahn et al., 2002; Harley, 2002). Rather, telomerase expression seems to stabilize chromosome structure and maintain genetic stability. If we could establish an ultra long-lived normal cell line instead of immortal cell line, it might become a better cell source for transplantation.

Ectopic expression of T-antigen of SV40 virus or E6/E7 of human papillomavirus has been used to immortalize human cells, but is rarely successful in establishing immortal cell lines (Pirisi et al, 1987; Watanabe et al., 1989). Furthermore, most of the infected cells achieved extended lifespan up to 100 PDs (population doublings), but had extremely short telomere, abnormal morphology and karyotypes which were unlike from those of normal senescent cells (Kumakura et al. 2002).

Normal human fibroblasts have been used as a model system for the study of cellular aging in vitro and in vivo (Hayflick and Moorhead, 1961; Martin et al., 1970). TIG-1 cell line from human embryonic lung was newly established in Japan for the study of cellular aging (Ohashi et al., 1980) and has been widely used as a standard normal cell with limited life span of approximately 65 PDs (Mitsui and Sakagami, 1983; Kumazaki et al., 1998).

We have established an ultra long-lived cell line and immortal cell strains by introducing TERT into TIG-1 cells. They showed no tumorigenicity, normal range of telomere length and near normal karyotypes. The aim of establishing a standard long-lived cell lines with normal phenotypes from TIG-1 and to pursue their usage for the tentative transplantation is discussed.

2. Materials and methods

2.1. Cell culture

A normal human diploid fetal lung fibroblasts (TIG-1) (Ohashi et al., 1980) and TERT-transfected cells were cultured in DMEM (Dulbecco's modified Eagle's medium; Sigma or Invitrogen) supplemented with 10% FBS (fetal bovine serum; Gibco). Cells were subcultured at the ratios of 1:2 to 1:16 once or twice a week depending on their growth rate. PDL (population doubling level) was calculated based on the split ratio but it was occasionally corrected by cell counting. Cells that could not grow for more than 2 weeks were considered to have reached their replicative life span. TIG-1 has a life span of 60–65 PDs. Therefore, cells proliferating beyond 75 PDL were considered ‘long-lived cells’, and beyond 140 PDL as referred to as ‘ultra long-lived cells’. Cells proliferating over 200 PDL were considered ‘immortalized’.

2.2. Transfection of TERT expression plasmid

pcDNA-hTERTn2 linearized with the restriction enzyme, BglII(Toyobo, Japan) was transfected into TIG-1 using human dermal fibroblast nucleofector kit (Lonza, Switzerland). Two series of experiments have been preformed. In the first experiment, 2.1 μg of pcDNA-hTERTn2 with neomycin-resistant gene was introduced by nucleofection into 1×106 TIG-1 fibroblasts at 19 PDL. In the second experiment, 4.2 μg of pcDNA-hTERTn2 and 1.5×106 cells TIG-1 at 20 PDL were used. The cells harbouring the plasmid formed colonies under culture in 200–400 μg/ml of G418 (Nacalai tesque, Japan or Alexis Biochemicals), and individual colony was isolated by using penicillin cup and trypsin. Each clone was cultured as above, but without G418.

2.3. RT–PCR (reverse transcription–PCR)

Total RNA was extracted from appropriate cells using RNeasy mini kit (Qiagen). The RNAs were treated with DNase using Turbo DNA-free kit (Ambion) to remove possibly contaminating DNA and reverse-transcribed using Transcriptor high fidelity cDNA synthesis kit (Roche). The resulting cDNAs were used as templates for PCR, done with Primestar HS DNA polymerase (Takara Bio, Japan). Primer sequences are listed in Table 1.


Table 1 Primer sequences for RT–PCR

Gene Primer Sequence
Collagen 1α Forward GGCAAGAGTGGTGATCGT
Reverse CGAACTGGAATCCATCGGT
Fibronectin Forward GACTATTGAAGGCTTGCAGCC
Reverse CTTGTGGGTGTGACCTGAGTG
GAPDH Forward ACCACAGTCCATGCCATCAC
Reverse TCCACCACCCTGTTGCTGTA
TERT Forward CCTGCTCAAGCTGACTCGACACCGTG
Reverse GGAAAAGCTGGCCCTGGGGTGGAGC



2.4. Immunoblot analysis

Cells were washed in ice-cold PBS twice, lysed in 1% Triton X-100 lysis buffer [50 mM Hepes, pH 7.4, 1% Triton X-100, 1% protease inhibitor cocktail (Sigma), 150 mM NaCl and 10% glycerol], and the lysates were clarified by centrifugation (15000 rev./min for 5 min). The cell lysates were subjected to SDS/PAGE and the separated proteins were transferred on to Immobilon-P membrane (Millipore) for immunoblotting. The blots were incubated in blocking solution [5% BSA in washing buffer (20 mM Tris/HCl, pH 7.5, 150 mM NaCl and 0.1% Tween 20)] and probed with a desired primary antibody diluted with blocking solution. After further washes, HRP (horseradish peroxidase)-conjugated secondary antibodies were applied. Positions of the primary antibody bound were visualized by ECL (enhanced chemiluminescence; GE Healthcare). The primary antibodies used were: rabbit polyclonal anti-p16 (C-20), anti-p21 (H-164), anti-p53 (DO-1) (Santacruz Biotech) and mouse monoclonal anti-β-tubulin (Sigma). The secondary antibodies were: HRP-linked F(ab′)2 fragment of anti-rabbit Ig from donkey (Amersham), and HRP-mouse immunoglobulins (Dako).

2.5. TRAP assay

Cell pellets were lysed in 1×lysis buffer of Quantitative telomerase detection kit (Allied Biotech) supplemented with 1% protease inhibitor cocktail (Sigma), and the lysates were centrifuged. The supernatants were stored at −80°C until used. Lysates equivalent to 1 μg of proteins were incubated for 30 min at 30°C with reagents of TRAPezetelomerase detection kit (Chemicon) for telomerase-mediated extension of TS primer. The reaction mixture was subjected to 33 cycles of PCR (30 s at 94°C, 30 s at 59°C and 1 min at 72°C). The PCR products were separated by PAGE on a 12.5% acrylamide gel, and the gel was stained with ethidium bromide to see 6 bp ladders.

2.6. Analysis of telomere length

Genomic DNAs from 0.5–2×106 cells were isolated by using Maxwell 16 DNA purification kit (Promega). DNAs (1 μg) were digested with restriction enzymes HinfI and RsaI, separated by electrophoresis on an agarose gel, and Southern blotted. Telomere sequence was detected on the blot by using TeloTAGGG telomere length assay kit (Roche). Mean length of TRFs (telomere restriction fragments) was determined by the method of Grant et al. (2001).

2.7. Detection of senescence-associated-β-galactosidase activity

Cells were washed with PBS and fixed with a fixative (2% formaldehyde and 0.2% glutaraldehyde in PBS) for 10 min at room temperature. The cells were washed 3 times with PBS and incubated with staining solution (5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 2 mM MgCl2, 150 mM NaCl, 1 mg/ml 5-bromo-4-chloro-3-indolyl-β-d-galactoside (X-Gal), 30 mM citric acid in phosphate buffer at pH 6.0) at 37°C overnight (Dimri et al., 1995). Stained cells in blue were counted as positive cells for senescence associated-β-galactosidase (SA-β-Gal) activity.

2.8. Analysis of anchorage independent growth

Cells (1×104) were seeded in 0.33% agar layer with DMEM containing 10% FBS and cultured for 2–3 weeks. Colonies formed in the agar layer were counted.

2.9. Tumour formation in immune-deficient mouse

Cells (1×106) of IMT-1 and ULT-1 were injected subcutaneously into lateral flanks of SCID (severe combined immune-deficient) mice (CLEA). After 12 weeks, the mice were killed and checked for tumour. Animal experiments were performed according to the protocols approved by the Animal Care and Use Committee of Tokushima Bunri University.

2.10. Analysis of karyotype

Karyotypes of established cell strains were analysed by G-band staining at the Nihon Gene Research Laboratories Inc.

3. Results

3.1. Life span profiles of TIG-1 by TERT transfection

A total of 74 individual G418-resistant clones were isolated from 30 culture dishes of TIG-1 transfected with TERT cDNA in the 2 experiments. Among them, 55 clones (74.3%) stopped to proliferate within normal life span (<75 PDL) ranging from 37 to 71 PDLs, and 16 clones (21.6%) had extended life spans (≥75 PDL), ranging from 80 to 136 PDL (Figure 1), where we refer to the latter as long-lived cells. A single clone of ultra long-lived cell was also obtained. Their morphology at terminal phase was like that of normal senescent cells. Cumulative growth curves of a typical long-lived cell clone, LT-1 and normal life span clone, MT-1 are shown in Figure 2(A).

3.2. Immortalization of normal human fibroblasts

Twenty G418-resistant colonies appeared from the TERT-transfected TIG-1 culture in the first experiment. Each colony was isolated as a clone and expanded further in separate culture dish. One clone among the 20 clones could be cultured for 550 days and was vigorously proliferating beyond 300 PDL (Figure 2A). Therefore, the clone was considered immortal, and was named IMT-1. IMT-1 had normal fibroblastic morphology comparable to young TIG-1 (Figures 3A and 3E).

In the second experiment, two immortal cell strains were established, IMT-2 (>250 PDL) and IMT-3 (>230 PDL) from 54 G418-resistant colonies (Figure 1). Thus, immortalizing 3 clones from 74 colonies was achieved, a frequency of 4.1%.

3.3. Character of IMT-1

To confirm that IMT-1 was immortal and therefore not going into senescence, we analysed SA-β-Gal activity (Dimri et al., 1995) in IMT-1 cells. Although 60.8% cells of senescent TIG-1 (56 PDL, 96% lifespan completed) stained positive for SA-β-Gal, only 0.4% of young TIG-1 cells (30 PDL) were positive (Figure 4A). In the case of IMT-1 (260 PDL), 2.2% cells were positively stained for SA-β-Gal (Figure 4B), which showed that IMT-1 cells at 260 PDL were equivalent to young cells.

Expression of TERT in IMT-1 was examined by RT–PCR. Young TIG-1 did not show TERT expression, but it was clearly detected in IMT-1 at 256 PDL (Figure 5A). Telomerase activity was also examined by TRAP assay (Figure 5B). Although the activity was not detected in TIG-1 at 26 PDL, it was found in IMT-1 of 55 PDL and even some increase in activity was found at 255 PDL. Immortality of IMT-1 must be supported by this activity.

Change of telomere length was analysed by Southern blot hybridization of genomic DNAs. Senescent TIG-1 (58 PDL) had shorter telomere than that of young TIG-1 (23 PDL) (Figure 5C). In the case of IMT-1, mean TRF lengths were much longer than that of young TIG-1 and maintained almost constant at least between 55 and 205 PDLs, but after 205 PDL TRF length was slightly shortened with increase in PDL, even though IMT-1 could proliferate over 330 PDL. Because TRF length of IMT-1 at 258 PDL was, however, longer than that of young TIG-1, it was clear that IMT-1 cells of 258 PDL could divide many times.

Levels of the tumour suppressor protein, p53, and its downstream protein p21CIP1, both of which are related to cellular senescence, were examined by Western blot analysis. Both protein levels were slightly lower in IMT-1 (326 PDL) than senescent TIG-1 (56 PDL) (Figures 6A and 6B). On the other hand, the level of p16INK4A known to increase with cellular senescence was undetectable in IMT-1 (Figure 6C), this level being comparable to that of young TIG-1 (data not shown). The level of p16INK4A was high in senescent TIG-1 (Figure 6C). The data suggest that IMT-1 can grow as well as young cells even over 300 PDL, and at present IMT-1 continues to grow vigorously beyond 450 PDL.

To confirm that IMT-1 were fibroblasts, we examined expression of fibroblast specific genes by RT–PCR. Expression of collagen 1α and fibronectin in IMT-1 at 256 PDL were high as those of young TIG-1 at 20 PDL (Figure 7), although the human immortal B lymphocyte cell line, N0005 (Kataoka et al., 1997; Takahashi et al., 2003) did not express fibronectin. Thus, IMT-1 holds fibroblastic character in its gene expression and morphology.

Change of TP53 gene was explored by genomic sequencing and no mutation was detected in its coding sequence (data not shown). Furthermore, IMT-1 at 251 PDL did not form colonies in soft agar or tumours in a SCID mouse, although HeLa cells gave many colonies in soft agar (data not shown). These results indicate that IMT-1 is non-tumorigenic.

Finally, analysis of karyotypes showed that IMT-1 had almost normal karyotype except for loss of one of the two X chromosomes (Figure 8).

3.4. Establishment of ultra long-lived fibroblast cell line and character of ULT-1

Since the probability of getting a ultra long-lived cell line was <5% (at most 1 from 20 clones) during the progress of first experiment, the second experiment was performed to obtain at least 3 cell lines by isolating larger number of clones from the original dishes. One clone among 54 individual clones from the second experiment could proliferate over 150 PDL (Figure 2A), suggesting immortalization. However, this clone began to grow slow after that point and finally reached senescence at 166 PDL (Figure 2A). It was confirmed morphologically that cells of the clone at 129 PDL looked like young TIG-1 and at 162 PDL like senescent TIG-1 (Figures 3C and 3D). Since this is unusually long life span, we thawed the stored cells of frozen clone at 130 PDL and conducted long-term culturing. Three independent cultures stopped their growth and senesced at 162, 162 and 163 PDLs, confirming their limited life spans (Figure 2B). Therefore, this clone was considered to be ultra long-lived cell line and was named ULT-1.

As high level of expression of TERT was detected in ULT-1 at 150 PDL by RT–PCR (Figure 5A), existence of telomerase activity was expected. Indeed, high telomerase activity was observed in ULT-1 at 57 PDL by TRAP assay. Interestingly, low telomerase activity was shown at 146 PDL (Figure 5B). It occurred despite of high level of TERT expression, suggesting changes in some regulatory factors against activity of the enzyme. This decrease of telomerase activity probably explains the exhaustion of ULT-1 life span. Analysis of mean TRF length showed that TRFs of ULT-1 were elongated ∼0.7 kb during 64 and 105 PDLs (Figure 5C). This elongation probably supported extended life span of ULT-1. However, TRF length at 151 PDL became very short, although the length was longer than that of parental TIG-1. ULT-1 could grow further 15 PDs. The degree of senescence was confirmed by the data of SA-β-Gal staining, where only 10.2% of ULT-1 cells at 152 PDL were positively stained (Figure 4C).

Levels of p21CIP1 and p53 in ULT-1 at 152 PDL were comparable to those of IMT-1 at 326 PDL (Figures 6B and 6C). Level of p16INK4A was higher than that of IMT-1, but lower than that of senescent TIG-1 (Figure 6A). Furthermore, ULT-1 cells could not form any tumour in an SCID mouse (data not shown). Karyotype analysis was nearly normal without loss of X chromosome in ULT-1 unlike in IMT-1 (data not shown). Thus, we obtained one ultra long-lived cell line of normal and non-tumorigenic character.

4. Discussion

4.1. Immortalization of TIG-1

Previously, we succeeded in establishing human immortal cell strains from normal skin fibroblasts and vascular endothelial cells by introduction of TERT gene (Kumazaki et al., 2004; Hiyama et al., 2005; Anno et al., 2007), and human B lymphocyte by infection of Epstein–Barr virus (Kataoka et al., 1997). We have now established new immortal cell strains from TIG-1 fibroblasts. As IMT-1 had TERT RNA expression and also telomerase activity, telomere sequence was elongated, where mean TRF length at 55 PDL was 5.4 kb longer than that of TIG-1 at 23 PDL (Figure 6C). After 55 PDL, TRF length was maintained almost constant until 205 PDL. However, shortened TRF length was observed at 258 PDL. Therefore, length of telomere sequence in IMT-1 decreased after 205 PDL (or as early as 110 PDL), even though increased telomerase activity was observed at 255 PDL. As TRF length decreased 2.9 kb between 205 and 258 PDLs, the length at 310 PDL was expected as 4.2 kb, which was shorter than that of senescent TIG-1, but at 310 PDL IMT-1 did not stop dividing. Instead of senescing, IMT-1 is proliferating even at 450 PDL as vigorously as young cells. Since the TRAP assay reflects telomerase activity, but not actual amount of catalytic subunit in cells, it is uncertain whether the amount of enzyme protein kept high or regulatory factors for telomerase activity had changed after 300 PDL.

4.2. Ultra extension of life span of TIG-1

In case of ULT-1, TERT expression was detected at 150 PDL (Figure 5A) and telomerase activity was confirmed at 57 and 146 PDL, although a decrease in telomerase activity at the higher PDL was observed (Figure 5B). Therefore, mean TRF length of ULT-1 at 64 PDL was elongated by 5 kb in comparison with that of TIG-1 at 23 PDL, and it was further elongated by 0.7 kb until 105 PDL (Figure 5C). However, like IMT-1, TRF length was changed to rapid decrease after 105 PDL, where 5.2 kb was lost until 151 PDL. As a TRF length of 6.5 kb is longer than that of parental TIG-1 (6.0 kb), it is expected that ULT-1 at 151 PDL can divide many more times. Indeed, although ULT-1 at 151 PDL was still proliferating, it stopped dividing eventually at 166 PDL after only 15 PDs. Independent reculturing of ULT-1 frozen at 130 PDL confirmed their mortal character. However, TRF does not give correct insight into the timing of senescence. TRF length of 5.3 kb in senescent TIG-1 is sufficient for the maintenance of telomere structure. It seems that signals to arrest cell proliferation could be activated even in cells with adequate lengths of telomere, just like senescent cell (58 PDL) with 5.3 kb of TRF. However, some cancer cell lines maintain TRFs as short as 3–4 kb (Counter et al., 1992). This may not be due to difference in cell type specific genetic background. Indeed, in the case of IMT-3 cell strain, TRF length decreased by 3.8 kb at 195 PDL but kept growing very well (data not shown). Increased expression of cell cycle regulators, such as p16INK4A, and increased number of SA-β-Gal stained cells as well as the enlarged morphology in the late passage of ULT-1 mimicked the phenotypes of normal senescent cells. Modulation of gene expression of cell cycle related regulators will be more important for immortalization.

4.3. Mechanisms of immortalization of TIG-1

Comparison of immortal cell strain, IMT-1, and ultra long-lived cell line, ULT-1 derived from the cells with the same genetic background uncovers some mechanisms of immortalization. Compared with IMT-1, expression level of TERT in ULT-1 did not decrease at 150 PDL (Figure 5A), but telomerase activity was lowered (Figure 5B), resulting in severely short telomere length (Figure 5C), although IMT-1 kept telomerase activity and long telomere length even at 255 PDL. Analysis of expression of cell cycle related proteins showed level of p53 and p21CIP1 unchanged among senescent TIG-1 (56 PDL), late ULT-1 (152 PDL) and IMT-1 (326 PDL) (Figures 6A and 6B). However, evident expression of p16INK4A was observed in both TIG-1 (56 PDL) and ULT-1 (152 PDL), although IMT-1 (326 PDL) had an undetectable level as young TIG-1 did. Thus, expressions of p53 and p21CIP1 proteins were not effective for cell growth arrest in IMT-1 cells, and maintenance of p16INK4A expression at suppressed level and telomerase activity might be key factors for immortal state of human fibroblast, as suggested for epithelial cells (Kiyono et al., 1998).

4.4. Usefulness of established cell lines

The established cell strain, IMT-1, has normal characteristics, including an almost normal karyotype and no growth in soft agar and immune-deficient mouse. Therefore, IMT-1 will be useful for cell transplantation and in vitro drug screening because of unlimited supply of normal cells of the same quality. However, in cell transplantation, this character of unlimited life span raises concern since emergence of cancer from the immortal cell cannot be completely excluded in vivo. On the other hand, we could obtain an ultra long-lived cell line, ULT-1, which has also normal and non-tumorigenic character. Since this cell line has limited lifespan, the possibility of transformation in vivo is very small. Therefore, it will be safer and more useful for cell transplantation. Early passage ULT-1 cells stored in liquid nitrogen will supply an abundant source of normal human cells. For instances, one vial of 20 PDL cells will produce 2100–1030 vials of cell at 120 PDL, which still leaves 45 PDs before final senescence. Thus, these cells of the same quality will be useful as a standard for screening of anti-aging agents and the safety of chemical substances, and more importantly be used to make artificial skin for isografts to cover debrided skin.

Recently, we succeeded in establishing induced pluripotent stem cells from the TIG-1 cells by introducing Oct4, Sox2, Klf4 and c-Myc (Kumazaki et al., 2011). Thus, useful cell lines for the study of both aging and differentiation have been developed from the cells with the same genetic background.

Author contribution

Tomoko Takahashi and Youji Mitsui conceived and designed experiments. Mizuna Kamada and Tsutomu Kumazaki performed experiments. Tomoko Takahashi and Taira Matsuo analysed the data. Mizuna Kamada, Tsutomu Kumazaki and Youji Mitsui wrote the paper.

Acknowledgement

We thank Dr F. Ishikawa of Kyoto University for providing the hTERT expression plasmid, pcDNA3-hTERTn2.

Funding

This work was supported by Tokushima Bunri University and a scholarship donation of “Foundation of Advancement of International Science” to Y.M.

REFERENCES

Anno, K, Hayashi, A, Takahashi, T, Mitsui, Y, Ide, T and Tahara, H (2007) Telomerase activation induces elongation of the telomeric single-stranded overhang, but does not prevent chromosome aberrations in human vascular endothelial cells. Biochem Biophys Res Commun 353, 926-932
Crossref   Medline   1st Citation   2nd  

Broccoli, D, Young, JW and de Lange, T (1995) Telomerase activity in normal and malignant hematopoietic cells. Proc Natl Acad Sci USA 92, 9082-9086
Crossref   Medline   1st Citation  

Counter, CM, Avilion, AA, LeFeuvrel, CE, Stewart, NG, Greider, CW and Harley, CB (1992) Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J 1, 1921-1929
1st Citation  

Cutler, C and Antin, JH (2001) Peripheral blood stem cells for allogeneic transplantation: a review. Stem Cells 19, 108-117
Crossref   Medline   1st Citation  

Dickson, MA, Hahn, WC, Ino, Y, Ronfard, V, Wu, JY and Weinberg, RA (2000) Human keratinocytes that express hTERT and also bypass a p16INK4a-enforced mechanism that limits life span become immortal yet retain normal growth and differentiation characteristics. Mol Cell Biol 20, 1436-1447
Crossref   Medline   1st Citation  

Dimri, GP, Lee, X, Basile, G, Acosta, M, Scott, G and Roskelley, C (1995) A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci USA 92, 9363-9367
Crossref   Medline   1st Citation   2nd  

Grant, JD, Broccoli, D, Muquit, M, Manion, FJ, Tisdall, J and Ochs, MF (2001) Telometric: a tool providing simplified, reproducible measurements of telomeric DNA from constant field agarose gels. BioTechniques 31, 1314-1318
Medline   1st Citation  

Gratwohl, A, Baldomero, H, Aljurf, M, Pasquini, MC, Bouzas, LF and Yoshimi, A (2010) Hematopoietic stem cell transplantation: a global perspective. JAMA, J Am Med Assoc 303, 1617-1624
Crossref   1st Citation  

Hahn, WC, Dessain, SK, Brooks, MW, King, JE, Elenbaas, B and Sabatini, DM (2002) Enumeration of the simian virus 40 early region elements necessary for human cell transformation. Mol Cell Biol 22, 2111-2123
Crossref   Medline   1st Citation  

Harley, CB (2002) Telomerase is not an oncogene. Oncogene 21, 494-502
Crossref   Medline   1st Citation  

Hayflick, L and Moorhead, PS (1961) The serial cultivation of human diploid cell strains. Exp Cell Res 25, 581-621
1st Citation   2nd  

Hiyama, K, Hirai, Y, Kyoizumi, S, Akiyama, M, Hiyama, E and Piatyszek, MA (1995) Activation of telomerase in human lymphocytes and hematopoietic progenitor cells. J Immunol 155, 3711-3715
Medline   1st Citation  

Hiyama, K, Otani, K, Ohtaki, M, Satoh, K, Kumazaki, T and Takahashi, T (2005) Differentially expressed genes throughout the cellular immortalization processes are quite different between normal human fibroblasts and endothelial cells. Int J Oncol 27, 87-95
Medline   1st Citation   2nd  

Kataoka, H, Tahara, H, Watanabe, T, Sugawara, M, Ide, T and Goto, M (1997) Immortalization of immunologically committed Epstein-Barr virus-transformed human B-lymphoblastoid cell lines accompanied by a strong telomerase activity. Differentiation 62, 203-211
Crossref   Medline   1st Citation   2nd  

Kiyono, T, Foster, SA, Koop, JI, McDougall, JK, Galloway, DA and Klingelhutz, AJ (1998) Both Rb/p16INK4A inactivation and telomerase activity are required to immortalize human epithelial cells. Nature 396, 84-88
Crossref   Medline   1st Citation   2nd  

Kumakura, S, Yamamoto, A, Yagisawa, J, Uchida, M and Tsutsui, T (2002) Telomere length and telomerase activity in the process of human fibroblast immortalization. Odontology 90, 13-21
Crossref   Medline   1st Citation  

Kumamoto, H, Kinouchi, Y and Ooya, K (2001) Telomerase activity and telomerase reverse transcriptase (TERT) expression in ameloblastomas. J Oral Pathol Med 30, 231-236
Crossref   Medline   1st Citation  

Kumazaki, T, Sakano, T, Yoshida, T, Hamada, K, Sumida, H and Teranishi, Y (1998) Enhanced expression of mitochondrial genes in senescent endothelial cells and fibroblasts. Mech Aging Dev 101, 91-99
Crossref   Medline   1st Citation  

Kumazaki, T, Hiyama, K, Takahashi, T, Omatsu, H, Tanimoto, K and Noguchi, T (2004) Differential gene expressions during immortalization of normal human fibroblasts and endothelial cells transfected with human telomerase reverse transcriptase gene. Int J Oncol 24, 1435-1442
Medline   1st Citation   2nd  

Kumazaki, T, Kurata, A, Matsuo, T, Mitsui, Y and Takahashi, T (2011) Establishment of human induced pluripotent stem cell lines from normal fibroblast TIG-1. Human Cell 24, 96-103
Crossref   Medline   1st Citation  

Martin, GM, Sprague, CA and Epstein, CJ (1970) Replicative life-span of cultivated human cells. Effects of donor's age, tissue, and genotype. Lab Invest 23, 86-92
Medline   1st Citation  

Mitsui, Y and Sakagami, H (1983) Histon H1 depletion with human cellular aging: biochemical and cytochemical evidences. Acta Histochem Cytochem 16, 403-414
Crossref   1st Citation  

Nivison-Smith, I, Bradstock, KF, Dodds, AJ, Hawkins, PA and Szer, J (2005) Haemopoietic stem cell transplantation in Australia and New Zealand, 1992-2001: progress report from the Australasian Bone Marrow Transplant Recipient Registry. Intern Med J 35, 18-27
Crossref   Medline   1st Citation  

Notaro, R, Cimmino, A, Tabarini, D, Rotoli, B and Luzzatto, L (1997) In vivo telomere dynamics of human hematopoietic stem cells. Proc Natl Acad Sci USA 94, 1378213785
1st Citation  

Ohashi, M, Aizawa, S, Ooka, H, Ohsawa, T, Kaji, K and Kondo, H (1980) A new human diploid cell strain, TIG-1, for the research on cellular aging. Exp Gerontol 15, 121-133
Crossref   Medline   1st Citation   2nd  

Pirisi, L, Yasumoto, S, Feller, M, Doninger, J and DiPaolo, JA (1987) Transformation of human fibroblasts and keratinocytes with human papillomavirus type 16 DNA. J Virol 61, 1061-1066
Medline   1st Citation  

Takahashi, T, Kawabe, T, Okazaki, Y, Itoh, C, Noda, K and Tajima, M (2003) In vitro establishment of tumorigenic human B-lymphoblastoid cell lines transformed by Epstein–Barr virus. DNA Cell Biol 22, 727-735
Crossref   Medline   1st Citation  

Watanabe, S, Kanda, T and Yoshiike, K (1989) Human papillomavirus type 16 transformation of primary human embryonic fibroblasts requires expression of open reading frames E6 and E7. J Virol 63, 965-969
Medline   1st Citation  

Yui, J, Chiu, CP and Lansdorp, PM (1998) Telomerase activity in candidate stem cells from fetal liver and adult bone marrow. Blood 91, 3255–-3262
Medline   1st Citation  


Received 26 August 2011/9 December 2011; accepted 25 January 2012

Published as Cell Biology International Immediate Publication 25 January 2012, doi:10.1042/CBI20110460


© The Author(s) Journal compilation © 2012 International Federation for Cell Biology


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)