Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2012) 36, 579–587 (Printed in Great Britain)
In vitro culture and induced differentiation of sheep skeletal muscle satellite cells
Haiqing Wu, Yu Ren, Shuo Li, Wei Wang, Jianlong Yuan, Xudong Guo, Dongjun Liu and Ming Cang1
Key Laboratory of Mammalian Reproductive Biology and Biotechnology Ministry of Education, Inner Mongolia University, Inner Mongolia, Hohhot 010021, Peoples Republic of China


Skeletal muscle satellite cells are adult muscle-derived stem cells receiving increasing attention. Sheep satellite cells have a greater similarity to human satellite cells with regard to metabolism, life span, proliferation and differentiation, than satellite cells of the rat and mouse. We have used 2-step enzymatic digestion and differential adhesion methods to isolate and purify sheep skeletal muscle satellite cells, identified the cells and induced differentiation to examine their pluripotency. The most efficient method for the isolation of sheep skeletal muscle satellite cells was the type I collagenase and trypsin 2-step digestion method, with the best conditions for in vitro culture being in medium containing 20% FBS+10% horse serum. Immunofluorescence staining showed that satellite cells expressed Desmin, α-Sarcomeric Actinin, MyoD1, Myf5 and PAX7. After myogenic induction, multinucleated myotubes formed, as indicated by the expression of MyoG and fast muscle myosin. After osteogenic induction, cells expressed Osteocalcin, with Alizarin Red and ALP (alkaline phosphatase) staining results both being positive. After adipogenic induction, cells expressed PPARγ2 (peroxisome-proliferator-activated receptor γ2) and clear lipid droplets were present around the cells, with Oil Red-O staining giving a positive result. In summary, a successful system has been established for the isolation, purification and identification of sheep skeletal muscle satellite cells.


Key words: adipogenesis, identification, myoblast, osteogenic, sheep, skeletal muscle satellite cell

Abbreviations: ALP, alkaline phosphatase, CEE, chick embryo extract, DMEM/F12, Dulbecco's modified Eagle's medium/Ham's nutrient mixture F-12, ECM, extracellular matrix, FBS, fetal bovine serum, GAPDH, glyceraldehyde-3-phosphate dehydrogenase, MDSC, muscle-derived satellite cell, MRF, myogenic regulatory factor, PPARγ2, peroxisome-proliferator-activated receptor γ2, RT–PCR, reverse transcription–PCR

1To whom correspondence should be addressed (email cangming1970@yahoo.com.cn).


1. Introduction

Lifelong maintenance of muscle mass and regenerative potential depends on the continuing presence of a functional pool of self-renewing MDSCs (muscle-derived satellite cells; Jang et al., 2011). Sheep skeletal muscle satellite cells have received a great deal of attention because they directly participate in skeletal muscle differentiation. MDSCs are muscle-derived stem cells in the muscle that can potentially proliferate and differentiate, were discovered by Mauro (1961) in an electron microscopic study of the frog anterior tibial muscle. Armand et al. (1983), Bischoff (1990) and Bischoff and Heintz (1994) found that MDSCs are located between the basement membrane and sarcolemma of skeletal muscle, making them difficult to isolate. The intermediate filament protein, desmin, and the striated muscle actin protein, α-sarcomeric actinin that is abundantly expressed in skeletal muscle cells, are involved in movement, and can be used to identify skeletal muscle cells in other tissues. Furthermore, the myogenic regulatory factors, Myf5 and MyoD1, are markers of the proliferation and differentiation of satellite cells. Pax7 also plays important roles in the maintenance of satellite cells. In the zebra fish, Pax7 expression marks muscle progenitor cells, and when muscle tissue are injured, Pax7+ cells migrate around the site of injury and enter the cell cycle, while adjacent fibres up-regulate MRF (myogenic regulatory factor) expression (Seger et al. 2011). Therefore, these 5 proteins can be used in combination to improve upon the previous methods of MDSC identification, allowing a comprehensive identification. Wright et al. (1989) showed that MyoG is a positive regulatory factor in skeletal muscle development that can promote the differentiation of MDSCs towards mature muscle cells; thus, it can be used as a marker for the differentiation of MDSCs.

MDSCs are the most important cell type involved in muscle regeneration after growth (Schultz 1989, 1996). Furthermore, these cells are easy to obtain for in vitro culture, can be isolated with little harm to the structure and function of the tissues and organs, are easy to culture, and have strong proliferation and differentiation capacities. These cells provide a stable model for tissue engineering studies, such as those involving the transplantation of MDSCs for muscle tissue reconstruction (Cornelison et al. 2000). Cousins et al. (2004) showed that mechanical injury as direct damage to muscles, or other diseases, such as DMD (Duchenne muscular dystrophy), could activate MDSCs. Thus, MDSCs play important roles in the regeneration and repair of muscle fibres after skeletal muscle injury. Furthermore, the established MDSC model can also be used to study the genes associated with muscle development, and as seed cells for animal biotechnology-related studies. Most MDSC studies have involved mice, rats and humans; in contrast, MDSC studies are rare in livestock, such as cows and sheep. Therefore, we investigated in vitro culture and differentiation of sheep MDSCs to establish a sheep cell line. Our findings provide an experimental basis for the research and application of MDSCs in other fields, such as livestock breeding and regenerative medicine.

2. Materials and methods

2.1. Experimental animals and the isolation, purification and culture of sheep MDSCs

Leg muscle tissues (4–5 g) were obtained from a 90-day-old Mongolian sheep fetus. The 2-step digestion method was performed using a modified version of the methods published by Dorfman et al. (1998) and Gharaibeh et al. (2008). The tissues were digested with 0.1% type I collagenase (Sigma) for 50 min and then digested with 0.25% trypsin (Gibco) for 10–20 min. The samples were vortexed every 10 min and filtered through a 100-mesh sieve. The cells were plated in culture dishes coated with 0.1% gelatin (Sigma) (Siegel et al., 2009) and 0.1% polylysine (Sigma) (Kuschel et al., 1999) at 1×106 cells/ml. Sheep MDSCs were purified using the differential adhesion method described by Gharaibeh et al. (2008). MDSCs were cultured in 3 different growth media to select an appropriate in vitro culture medium for room temperature culture of MDSCs. Preparation of the culture media is described in Table 1.


Table 1 Preparation of culture media

Culture medium Component
Medium A 20% FBS (HyClone)+80% DMEM/F12 (Dulbecco's modified Eagle's medium/Ham's nutrient mixture F-12; HyClone)
Medium B 15% horse serum (Gibco)+85% DMEM/F12
Medium C 20% FBS+10% horse serum+70% DMEM/F12
Myogenic induction medium 2% horse serum+98% DMEM/F12
Osteogenic induction medium DMEM/F12+10% horse serum+10 mmol/l sodium β-glycerophosphate (Sigma)+20 nmol/l dexamethasone (Sigma)+50 μg/ml ascorbic acid (Sigma)
Adipogenic induction medium DMEM/F12+15% horse serum +10 μg/l insulin (Sigma)+1 μmol/l dexamethasone+0.5 mmol/l IBMX (Sigma)+200 μmol/l indomethacin (Sigma)



2.2. MDSCs growth curves

Tenth-generation MDSCs were used to prepare a single-cell suspension. After counting, the cells were plated in 2×24-well plates at 104 cells/ml. One millilitre of culture medium B was added to each well in 1 culture plate, and 1 ml of culture medium C was added to each well in the other plate. After 2 days of culture at room temperature, 3 wells of cells were counted daily for 8 days to generate a growth curve.

2.3. Immunofluorescence staining and RT–PCR (reverse transcription–PCR)-based identification of MDSCs

Fifth-generation MDSCs were plated in 24-well culture plates at 1×105 cells/ml. When the cells were >80% confluent, they were stained by immunofluorescence as described by Beauchamp et al. (2000). The cells were fixed in 4% (w/v) paraformaldehyde (Sigma), permeabilized, blocked and stained with mouse anti-desmin (Boster), mouse anti-α-sarcomeric actinin (Boster), mouse monoclonal anti-MyoD1 (Abcam), rabbit monoclonal anti-Myf5 (Abcam), or mouse monoclonal anti-PAX7 antibodies (Abcam) at 1:200 dilutions. Sheep fibroblasts were used as the negative control, and were accordingly processed. The cells were stained with FITC-labelled secondary antibodies, and nuclei were stained with propidium iodide. The cells were observed at room temperature by confocal microscopy (BX61, Olympus). RT–PCR (Takara) was used to detect the expression of Myf5 and MyoD1 in MDSCs. The design of primers and reaction conditions is given in Table 2.


Table 2 Primers

Gene Forward primers (5′–3′) Reverse primers (5′–3′) Length (bp)
GAPDH (glyceraldehyde-3-phosphate dehydrogenase) TGAACGGGAAGCTCACTGG TCCACCACCCTGTTGCTGTA 360
GAPD TTCAACGGCACAGTCAAGG ACATACTCAGCACCAGCATCAC 119
Osteocalcin GGTGCAGACCTAGCAGACA GTGCCGTCCATACTTTCG 424
PPARγ2 GAGCATGGTGCCTTCGCTGA AGCAAGGCACTTCTGAAACCGA 564
Myf5 CACAACCAACCCTAACCA TGATCCGATCCACTATGC 313
MyoD1 TTCCCTGAGACCCGCTGTG TCGCCTGCCTGCCGTAT 425
MyoG GCGGAAGTCGGTGTCTGT ATTGTGGGCATCTGTAGGGT 370



2.4. Flow cytometry

The expression of desmin, α-sarcomeric actinin, MyoD1, Myf5 and PAX7 in 10th and 20th generation MDSCs was detected using flow cytometry. The cells were fixed in 2 ml of 4% paraformaldehyde at room temperature for 40 min. They were resuspended in 1 ml of PBS containing 0.2% Triton X-100 (Sigma) and 5% goat blocking serum and placed on ice for 10 min before centrifuging at 400 g for 5 min. The cells were incubated with saturated unlabelled antibodies on ice for 40 min. The cells were then incubated with FITC-labelled secondary antibodies (Boster) for 40 min on ice in the dark. The cells were resuspended and fixed in 0.5 ml of 1% paraformaldehyde for subsequent tests. The fluorescence values were measured by flow cytometry. The number of cells in each tube was >106 cells. PBS was used to replace primary antibodies in the negative controls.

2.5. Chromosomal analysis of MDSCs

Experiments followed the procedure of Zhang et al. (2008). During exponential phase, 10th and 20th generation MDSCs were treated with 0.1 μg/ml colchicine for 4 h. The cells were harvested and incubated in 5 ml of preheated hypotonic solution (0.075 M KCl) at 37°C for 20 min. One millilitre of a new, low-permeability prepared fixative (methanol: acetic acid  = 3:1) was added. After centrifugation, 1 ml of fixative was added to the cell suspension, which was dropped with a pipette on to glass slides that had been frozen at −20°C. Chromosomes were spread on the clean glass slides by the gradual fixation and air-drying. The samples were stained with Giemsa (1:9) for 15 min for conventional analysis (Nikon 80i).

2.6. Myogenic induction and identification of MDSCs

Eighty percent confluent 3rd generation MDSCs were cultured in myogenic induction medium (Table 1). Once myotubes had clearly appeared, the nuclei were stained at room temperature with Hoechst 33342 (5 mg/l) (Sigma) to observe their morphology (Nikon C-SHG1). The cells were collected, and MyoG expression detected by RT–PCR. The expression of fast muscle myosin was identified using immunocytochemistry (Boster). Primer design and PCR conditions are described in Tables 2 and 3.


Table 3 PCR conditions

Gene PCR conditions
GAPDH 94°C 4 min, 94°C 60 s, 60°C 45 s, 72°C 60 s, 72°C 10 min, 30 cycles
GAPD 94°C 4 min, 94°C 60 s, 60°C 30 s, 72°C 30 s, 72°C 10 min, 30 cycles
Osteocalcin 94°C 4 min, 94°C 30 s, 56°C 30 s, 72°C 30 s, 72°C 10 min, 35 cycles
PPARγ2 94°C 4 min, 94°C 30 s, 56°C 30 s, 72°C 30 s, 72°C 10 min, 35 cycles
Myf5 94°C 4 min, 94°C 60 s, 58°C 45 s, 72°C 60 s, 72°C 10 min, 30 cycles
MyoD1 94°C 4 min, 94°C 30 s, 56°C 30 s, 72°C 30 s, 72°C 10 min, 30 cycles
MyoG 94°C 4 min, 94°C 60 s, 58°C 30 s, 72°C 60 s, 72°C 10 min, 30 cycles



2.7. Osteogenic induction and identification of MDSCs

Eighty percent confluent 3rd generation MDSCs were cultured in osteogenic induction medium (Table 1). After 21 days culture, the cells were stained and identified using Alizarin Red (Sigma) and ALP (alkaline phosphatase; Alkaline Phosphatase Colorimetric Assay Kit). The cells were examined at room temperature under a microscope (Nikon C-SHG1). Expression of the osteoblast marker protein, osteocalcin, was detected by RT–PCR. Primer design and PCR conditions are described in Tables 2 and 3.

2.8. Adipogenic induction and identification of MDSCs

Eighty percent confluent 3rd generation MDSCs were cultured in adipogenic induction medium (Table 1). After 21 days culture, the cells were stained with Oil Red-O (Sigma), and the formation of lipid droplets was followed at room temperature microscopically (Nikon C-SHG1). PPARγ2 (peroxisome-proliferator-activated receptor γ2) expression was detected by RT–PCR, the primer design and PCR conditions being described in Tables 2 and 3.

3. Results

3.1. Isolation and purification of sheep MDSCs

The most efficient isolation of MDSCs was achieved by type I collagenase digestion for ∼50 min. The optimal length of trypsin digestion was 10–20 min; when trypsin digestion proceeded for >30 min, the efficiency of MDSC isolation decreased significantly, and the cell death rate increased. The best MDSC isolation efficiency was achieved with type I collagenase digestion for 50 min and trypsin digestion for 15 min.

Gelatin promoted cell attachment, whereas polylysine was unsuitable and the adherent growth of newly separated satellite cells was difficult to achieve on untreated plates. After 2 h of culture, most of the non-specific cells had already attached. The majority of the non-attached MDSCs were transferred along with the culture medium to new gelatin-treated culture plates to promote adherent growth. The newly separated MDSCs were spherical and displayed strong refractivity. After 10–14 h, the cells began to attach to the plates; some of the adherent cells had round, spindle, or polygonal shapes, (Figure 1A). After 48–72 h, all of the cells were attached, and they gradually extended into spindle or polygonal shapes (Figure 1B). After 30 min, the activated cells began to attach, and all the cells became adherent within 12 h. Proliferation of activated MDSCs was significantly increased when compared with that of primary cells. In culture medium A, cell growth was vigorous and cell morphology was normal after the inoculation of 2nd generation cells (Figure 1F). By the 3rd generation, however, some fused cells were seen, and the refractivity increased; during the culture process, more fusion occurred. Five days after inoculation, half of the cells were fused, had long tubular shapes and significantly larger volumes than single MDSCs, and many nuclei could clearly be seen in the swollen regions of the cytoplasm. These features indicate the formation of myotubes (Figure 1G). Cells in media B and C had normal morphology and did not differentiate until the 20th generation (Figures 1C–1E, Medium B; Figures 1H–1J, Medium C). These results indicate that media B and C can be used for the in vitro culture of MDSCs.

3.2. Growth curve of sheep MDSCs

MDSCs cultured in medium B rapidly proliferated after 2 days and reached a plateau on day 6. The proliferation of the cells in culture medium C reached a plateau at approximately day 7. Overall, when seeded at the same density and grown in the same culture conditions, the growth rate of the cells cultured in medium C was faster than that of cells cultured in medium B. These results indicate that MDSCs grew normally in vitro (Figure 2); therefore, medium C was used in the subsequent studies.

3.3. Immunofluorescence staining and RT–PCR-based identification of MDSCs

Relative to the negative control (Figures 3A–3E), the expression of desmin, α-sarcomeric actinin, MyoD1, Myf5 and PAX7 were all positive in 5th generation MDSCs (Figures 3A–3E). Furthermore, RT–PCR results showed that MyoD1 and Myf5 were both expressed (Figures 3F and 3G), confirming that the isolated cells were MDSCs.

3.4. Flow cytometric analysis of MDSCs

Flow cytometric analysis showed that desmin, α-sarcomeric actinin, MyoD1, Myf5 and PAX7 expressions in 10th and 20th generation MDSCs were all expressed during the culture process (Figure 4). This indicates that the isolated cells did not differentiate during the culture process, but maintained the MDSC phenotype.

3.5. Chromosomal analysis

Most cells had a 2n chromosome number (54 chromosomes); 93% (28/30) of the 10th generation cells had normal diploid chromosome numbers (Figure 5A), whereas 83% (25/30) for the 20th generation cells (Figure 5B). Karyotype analysis showed that in long-term culture, sheep MDSCs can undergo normal chromosome replication and division.

3.6. Myogenic induction of MDSCs

Five days after myogenic induction, MDSCs began to fuse and form short myotubes. With prolonged cell growth, cell density increased, fusion between cells became more extensive, myotubes were formed, the length of the myotubes increased significantly and several nuclei could be seen in myotubes after Hoechst 33342 staining (Figure 6A). Immunocytochemical staining showed expression of fast muscle myosin (Figure 6B), and RT–PCR demonstrated expression of MyoG (Figure 6C), confirming that MDSCs can be induced to differentiate into muscle cells.

3.7. Osteogenic induction of MDSCs

Upon osteogenic induction, MDSCs displayed monoclonal-like growth; the cells changed from irregular shapes to spindle shapes. Typical single cell clones appeared after 12 days. Cells began to aggregate after 18 days, and formation of ossified nodules was evident after 21 days. Alizarin Red staining (Figure 7A) and ALP staining (Figure 7B) were positive. PCR results showed that osteocalcin was expressed in differentiated cells (Figure 7C). Thus MDSCs can be induced to differentiate into osteoblasts.

3.8. Adipogenic induction of MDSCs

Eleven days after adipogenic induction, tiny oil droplets with circular, polygonal and spindle shapes were present in the media near MDSCs. With time, the number of small oil droplets gradually increased; large lipid droplets appeared after 18 days, and Oil Red-O staining was positive after 21 days (Figure 8A). MDSCs also expressed PPARγ2 after adipogenic induction (Figure 8B), confirming that MDSCs can be differentiated into lipid cells by changes in culture conditions.

4. Discussion

The purpose of this study was to establish a method for the in vitro isolation and purification of sheep MDSCs and find a more comprehensive identification method for them. The number of MDSCs decrease with age. To meet research needs, we have successfully isolated sheep MDSCs and optimized protein identification, cell proliferation, and their pluripotent differentiation capability.

The cells are tightly connected; MDSCs are tissue stem cells localized between the sarcolemma of the muscle fibres and the basement membrane. They are resistant to the action of general digestive enzymes (Rosenblatt et al., 1996). In contrast with the method of Gharaibeh et al. (2008) (0.2% type IV collagenase digestion for 1 h followed by 0.1% trypsin digestion for 30 min), our two-step digestion method achieved better separation using digestion with 0.1% type I collagenase for 50 min followed by digestion with 0.25% trypsin for 10–20 min. Type I and type IV collagenases can both be used to digest the connective layers between the tissues to isolate single cells; however, type IV collagenase is a mixture of enzymes and is less effective for cell separation than type I collagenase at the same concentration. Our use of type I collagenase reduced the amount of enzyme required and decreased digestion time. Higher concentrations of trypsin also have effects on cell growth; however, for dense muscle fibres, an increase in the trypsin concentration and a decrease in the digestion time can increase the release rate and the yield of MDSCs.

Proteins extracted from the ECM (extracellular matrix) are used as substrates to promote cell attachment, the most common substrates being gelatin, collagen, polylysine, laminin and fibronectin. These substrates can significantly promote cell attachment in vitro and have differing effects on cell proliferation and differentiation (Burton et al., 2000). We have demonstrated that freshly isolated, non-activated MDSCs are in a dormant state and have difficulty attaching to the bottom of untreated culture plates. Similar to studies performed by Siegel et al. (2009) in mice, gelatin was conducive to the attachment of sheep MDSCs, whereas polylysine was unsuitable. Gelatin has a high affinity for MDSCs, whereas polylysine may have some toxic effects on cells, and although Kuschel et al. (1999) showed that polylysine could promote the attachment of rat MDSCs, it did not promote the attachment of sheep MDSCs as well as gelatin. Using the Gharaibeh et al. (2008) method, we consistently isolated MDSCs from a trypsin solution containing a mixture of cells such as MDSCs, fibroblasts and epithelial cells. The digestion time needs to be controlled, as the purity of the MDSCs decreases when it is too short, and the activity and yield of the MDSCs decreases when it is too long. After activation, MDSCs no longer require cell attachment substrates. Cell attachment seems to be associated with the electric charges of membrane. It is possible that the physiological activities of activated MDSCs increase, changing electric charges of membranes. Rando and Blau (1994), Alessandri et al. (2004) and Richler and Yaffe (1970) showed that the addition of horse serum and CEE (chick embryo extract) effectively maintained the self-renewal capacity of MDSCs (in mouse, rat and man), allowing successful isolation of MDSCs. We found that CEE was not necessary for the maintenance of stem cell characteristics in sheep MDSCs, as 20th generation cells maintained normal morphology. Furthermore, we demonstrated that FBS and horse serum can both promote MDSC growth within an acceptable range of serum concentrations; a higher serum concentration gives better cell growth. Horse serum might contain factors that maintain the stem cell characteristics of MDSCs, factors sufficient also to maintain the stem cell characteristics of sheep MDSCs.

MDSCs are a type of muscle-derived stem cell in which desmin is one of the components of the cytoskeleton (Sanoudou et al., 2006; Stratos et al., 2007). α-Sarcomeric actinin is a major component of the myofilaments that participates in contraction to complete many of the mechanical movements of the body (Sejersen and Lendahl, 1993). MRFs such as MyoD gene family members belong to the myogenic basic helix-loop-helix transcription factor family. This family contains 4 members: MyoD1, Myf5, MyoG (Myogenin) and MRF4 (Myf6) (Megeney and Rudnicki, 1995; Arnold and Winter, 1998). Of these proteins, Myf5 is the first expressed in muscle progenitor cells during embryonic development. Myf5 and MyoD1 have complementary functions upstream of the MyoG and MRF4 pathways that activate synthesis of skeletal muscles. MyoD1, which is expressed only in activated satellite cells, is the earliest marker in the formation of skeletal muscles, and transforms many types of cells into muscle cells while promoting fusion of muscle cells into myotubes; however, it is not expressed in resting satellite cells. MyoD1 exerts its function through the regulation of the actin gene. The E-box site, one of several transcription factor binding sites in the mammalian α-sarcomeric actinin gene promoter, is the binding site for the myogenic regulatory factors, MyoD1 and Myogenin (Gros et al., 2005). In activated MDSCs, MyoD1 and PAX7 (Paired Box Homeotic Gene 7), which is closely associated with the growth and repair of muscles after birth are expressed simultaneously. PAX7 is also expressed during the differentiation, proliferation and activation of satellite cells (Grounds et al., 1992; Yablonka-Reuveni and Rivera, 1994). PAX7 can maintain satellite cells and has an important anti-apoptotic function in activated satellite cells (Oustanina et al., 2004; Zammit et al., 2006). We detected the expression of desmin, α-sarcomeric actinin, MyoD1, Myf5 and PAX7 at the protein level, and MyoD1 and Myf5 at the RNA level. These results are consistent with previous reports, indicating that our isolated and purified cells are indeed sheep MDSCs. Identification of MDSCs by immunohistochemistry and PCR increased the reliability of these observations, thus avoiding the controversy associated with using a single method to identify these cells. By flowcytometry, karyotype analysis and observation of cell morphology, we confirmed that 10th and 20th generation MDSCs had not differentiated, but retained the full characteristics of stem cells. This indicates that the methods we used gave a higher degree of purity than has been obtained in previous studies.

Bischoff and Heintz (1994) demonstrated that under different culture conditions, MDSCs could form different types of mesodermal cells such as osteoblasts and fat cells as well as ectodermal cells such as neurons. We used different conditions to induce MDSCs to differentiate into muscle cells, osteoblasts and fat cells, thus confirming that the isolated MDSCs were pluripotent.

Nutrient reduction leads to MDSC fusion. Low serum concentrations stimulate the production of SRF (serum response factor), which is an essential factor for the growth and maturation of skeletal muscle (Li et al., 2005). Therefore, a low concentration of horse serum stimulates the differentiation of satellite cells into mature muscle cells. Secondary myogenic regulatory factors including myogenin and MRF4 regulate terminal differentiation of muscle cells and are expressed both during differentiation through to its late stages. Furthermore, myogenin can also be used as a marker for cell differentiation. MyoG is necessary for the development of functional skeletal muscle, and the MyoG gene is the only MRF gene family member expressed in all skeletal muscle cell lines (Hasty et al., 1993; Nabeshima et al., 1993). After myogenic induction, the expression of the myogenin gene is up-regulated, fast muscle myosin is expressed and myotubes are formed.

Osteocalcin, a non-collagen protein in bone matrix, is considered a marker for osteoblasts, and is secreted mainly by them (Zuk et al., 2002). The conformation of osteocalcin is calcium-dependent; therefore, calcium deposition in the cell matrix directly reflects the degree of osteogenesis. Alizarin Red contains a hydroxy anthraquinone structure that binds to calcium ions to form a red complex; thus, it is a relatively specific and commonly used to detect calcium deposition in the matrix (Vilmann, 1969; Perinpanayagam et al., 2004). Chen (2004) found that dexamethasone, vitamin C and sodium β-glycerophosphate were essential for the differentiation of osteoblasts and in vitro osteogenesis. Dexamethasone can promote the differentiation and maturation of osteoblasts, and also increases ALP activity and promotes the synthesis of ECM collagen. Vitamin C can promote collagen synthesis and calcification, regulate ALP activity and the synthesis of non-collagen bone matrix protein. Sodium β-glycerophosphate provides phosphate ions for osteoblasts and promotes the deposition and calcification of physiological calcium, which is essential for the formation of mineralized nodules. ALP can hydrolyse organic phosphate to release inorganic phosphorus, resulting in the formation of hydroxyapatite, which is a required enzyme for bone formation.

PPARγ2 is a specific transcriptional regulator for both the differentiation of pre-adipocytes into mature fat cells and the accumulation of TAGs (triacylglycerols) in fat cells (Tontonoz et al., 1994). Dexamethasone is a dose-dependent inducer of osteoblasts and fat cells. At low concentrations, it induces cells to become osteoblasts, whereas at high concentrations, it functions with insulin to activate the glucocorticoid receptor, and activates the expression of PPARγ2, thus activating the fat cell genes at the transcriptional level and differentiating the cells into fat cells.

In summary, a new method for the isolation and purification of sheep MDSCs is described, providing the foundations for further research in muscle development, tissue engineering, gene therapy and gene function. Furthermore, the establishment of the sheep MDSC model is also significant for the study of transgenic sheep produced for meat. This model can be used for the in vitro screening of meat quality-related genes, the identification of specific promoter, the functions of target genes and the discovery of new genes. In addition, MDSCs can be applicable to transgenic cloning as nuclear donor cells.

Author contribution

The experiments involving purification and identification of MDSCs, myogenic induction, MDSCs growth curves, flow cytometry and chromosomal analysis of MDSCs were carried out by Haiqing Wu. The experiments involving osteogenic induction and adipogenic induction were carried out by Yu Ren. The cell culture was carried out by Shuo Li, Wei Wang, Jianlong Yuan, Xudong Guo, Dongjun Liu and Ming Cang.

Funding

This work was supported by the breeding program for high-quality new varieties of genetically modified sheep from the National Major Transgenic Project [grant number 2008ZX08008-003-01].

REFERENCES

Alessandri, G, Pagano, S, Bez, A, Benetti, A, Pozzi, S and Iannolo, G (2004) Isolation and culture of human muscle-derived stem cells able to differentiate into myogenic and neurogenic cell lineages. Lancet 364, 1872-83
Crossref   Medline   1st Citation  

Armand, O, Boutineau, AM, Mauger, A, Pautou, MP and Kieny, M (1983) Origin of satellite cells in avian skeletal muscles. Arch Anat Microsc Morphol Exp 72, 163-81
Medline   1st Citation  

Arnold, HH and Winter, B (1998) Muscle differentiation: more complexity to the network of myogenic regulators. Curr Opin Genet Dev 8, 539-44
Crossref   Medline   1st Citation  

Beauchamp, JR, Heslop, L, Yu, DS, Tajbakhsh, S, Kelly, RG and Wernig, A (2000) Expression of CD34 and Myf5 defines the majority of quiescent adult skeletal muscle satellite cells. J Cell Biol 151, 1221-34
Crossref   Medline   1st Citation  

Bischoff, R (1990) Interaction between satellite cells and skeletal muscle fibers. Development 109, 943-52
Medline   1st Citation  

Bischoff, R and Heintz, C (1994) Enhancement of skeletal muscle regeneration. Dev Dyn 201, 41-54
Crossref   Medline   1st Citation   2nd  

Burton, N, Vierck, MJ, Krabbenhoft, L, Bryne, K and Dodson, MV (2000) Methods for animal satellite cell culture under a variety of conditions. Methods Cell Sci 22, 51-61
Crossref   Medline   1st Citation  

Chen, TL (2004) Inhibition of growth and differentiation of osteoprogenitors in mouse bone marrow stromal cell cultures by increased donor age and glucocorticoid treatment. Bone 35, 83-95
Crossref   Medline   1st Citation  

Cornelison, DD, Olwin, BB, Rudnicki, MA and Wold, BJ (2000) MyoD(-/-) satellite cells in single-fiber culture are differentiation defective and MRF4 deficient. Dev Biol 224, 122-37
Crossref   Medline   1st Citation  

Cousins, JC, Woodward, KJ, Gross, JG, Partridge, TA and Morgan, JE (2004) Regeneration of skeletal muscle from transplanted immortalised myoblasts is oligoclonal. J Cell Sci 117, 3259-69
Crossref   Medline   1st Citation  

Dorfman, J, Duong, M, Zibaitis, A, Pelletier, MP, Shum-Tim, D, Li, C and Chiu, RC (1998) Myocardial tissue engineering with autologous myoblast implantation. J Thorac Cardiovasc Surg 116, 744-51
Crossref   Medline   1st Citation  

Gharaibeh, B, Lu, A, Tebbets, J, Zheng, B, Feduska, J and Crisan, M (2008) Isolation of a slowly adhering cell fraction containing stem cells from murine skeletal muscle by the preplate technique. Nat Protoc 3, 1501-09
Crossref   Medline   1st Citation   2nd   3rd   4th  

Gros, J, Manceau, M, Thome, V and Marcelle, C (2005) A common somitic origin for embryonic muscle progenitors and satellite cells. Nature 435, 954-58
Crossref   Medline   1st Citation  

Grounds, MD, Garrett, KL, Lai, MC, Wright, WE and Beilharz, MW (1992) Identification of skeletal muscle precursor cells in vivo by use of MyoD1 and myogenin probes. Cell Tissue Res 267, 99-104
Crossref   Medline   1st Citation  

Hasty, P, Bradley, A, Morris, JH, Edmondson, DG, Venuti, JM, Olson, EN and Klein, WH (1993) Muscle deficiency and neonatal death in mice with a targeted mutation in the myogenin gene. Nature 364, 501-6
Crossref   Medline   1st Citation  

Jang, YC, Sinha, M, Cerletti, M, Dall'osso, C and Wagers, AJ (2011) Skeletal Muscle Stem Cells: Effects of Aging and Metabolism on Muscle Regenerative Function. Cold Spring Harb Symp Quant Biol
Medline   1st Citation  

Kuschel, R, Yablonka-Reuveni, Z and Bornemann, A (1999) Satellite cells on isolated myofibers from normal and denervated adult rat muscle. J Histochem Cytochem 47, 1375-84
Crossref   Medline   1st Citation   2nd  

Li, S, Czubryt, MP, McAnally, J, Bassel-Duby, R, Richardson, JA and Wiebel, FF (2005) Requirement for serum response factor for skeletal muscle growth and maturation revealed by tissue-specific gene deletion in mice. Proc Natl Acad Sci USA 102, 1082-87
Crossref   Medline   1st Citation  

Mauro, A (1961) Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol 9, 493-95
Crossref   Medline   1st Citation  

Megeney, LA and Rudnicki, MA (1995) Determination versus differentiation and the MyoD family of transcription factors. Biochem Cell Biol 73, 723-32
Crossref   Medline   1st Citation  

Nabeshima, Y, Hanaoka, K, Hayasaka, M, Esumi, E, Li, S and Nonaka, I (1993) Myogenin gene disruption results in perinatal lethality because of severe muscle defect. Nature 364, 532-35
Crossref   Medline   1st Citation  

Oustanina, S, Hause, G and Braun, T (2004) Pax7 directs postnatal renewal and propagation of myogenic satellite cells but not their specification. EMBO J 23, 3430-39
Crossref   Medline   1st Citation  

Perinpanayagam, H, Schneider, G, Holtman, K, Zaharias, R and Stanford, C (2004) Altered Cbfa1 expression and biomineralization in an osteosarcoma cell line. J Orthop Res 22, 404-10
Crossref   Medline   1st Citation  

Rando, TA and Blau, HM (1994) Primary mouse myoblast purification, characterization, and transplantation for cell-mediated gene therapy. J Cell Biol 125, 1275-87
Crossref   Medline   1st Citation  

Richler, C and Yaffe, D (1970) The in vitro cultivation and differentiation capacities of myogenic cell lines. Dev Biol 23, 1-22
Crossref   Medline   1st Citation  

Rosenblatt, JD, Parry, DJ and Partridge, TA (1996) Phenotype of adult mouse muscle myoblasts reflects their fiber type of origin. Differentiation 60, 39-45
Crossref   Medline   1st Citation  

Sanoudou, D, Corbett, A, Han, M, Ghoddusi, M, Nguyen, MA, Vlahovich, N, Hardeman, EC and Beggs, AH (2006) Skeletal muscle repair in a mouse model of nemaline myopathy. Hum Mol Genet 15, 2603-12
Crossref   Medline   1st Citation  

Schultz, E (1989) Satellite cell behavior during skeletal muscle growth and regeneration. Med Sci Sports Exerc 21, S181-6
Medline   1st Citation  

Schultz, E (1996) Satellite cell proliferative compartments in growing skeletal muscles. Dev Biol 175, 84-94
Crossref   Medline   1st Citation  

Seger, C, Hargrave, M, Wang, X, Chai, RJ, Elworthy, S and Ingham, PW (2011) Analysis of Pax7 expressing myogenic cells in zebrafish muscle development, injury, and models of disease. Dev Dyn 240, 2440-51
Crossref   Medline   1st Citation  

Sejersen, T and Lendahl, U (1993) Transient expression of the intermediate filament nestin during skeletal muscle development. J Cell Sci 106, 1291-1300
Medline   1st Citation  

Siegel, AL, Atchison, K, Fisher, KE, Davis, GE and Cornelison, DD (2009) 3D timelapse analysis of muscle satellite cell motility. Stem Cells 27, 2527-38
Crossref   Medline   1st Citation   2nd  

Stratos, I, Rotter, R, Eipel, C, Mittlmeier, T and Vollmar, B (2007) Granulocyte-colony stimulating factor enhances muscle proliferation and strength following skeletal muscle injury in rats. J Appl Physiol 103, 1857-63
Crossref   Medline   1st Citation  

Tontonoz, P, Hu, E, Graves, RA, Budavari, AI and Spiegelman, BM (1994) mPPAR gamma 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8, 1224-34
Crossref   Medline   1st Citation  

Vilmann, H (1969) The in vivo staining of bone with alizarin red S. J Anat 105, 533-45
Medline   1st Citation  

Wright, WE, Sassoon, DA and Lin, VK (1989) Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD. Cell 56, 607-17
Medline   1st Citation  

Yablonka-Reuveni, Z and Rivera, AJ (1994) Temporal expression of regulatory and structural muscle proteins during myogenesis of satellite cells on isolated adult rat fibers. Dev Biol 164, 588-603
Crossref   Medline   1st Citation  

Zammit, PS, Relaix, F, Nagata, Y, Ruiz, AP, Collins, CA, Partridge, TA and Beauchamp, JR (2006) Pax7 and myogenic progression in skeletal muscle satellite cells. J Cell Sci 119, 1824-32
Crossref   Medline   1st Citation  

Zhang, P, Li, W, Friebe, B and Gill, BS (2008) The origin of a zebra chromosome in wheat suggests nonhomologous recombination as a novel mechanism for new chromosome evolution and step changes in chromosome number. Genetics 179, 1169-77
Crossref   Medline   1st Citation  

Zuk, PA, Zhu, M, Ashjian, P, De Ugarte, DA, Huang, JI and Mizuno, H (2002) Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell 13, 4279-95
Crossref   Medline   1st Citation  


Received 11 September 2011/14 November 2011; accepted 11 January 2012

Published as Cell Biology International Immediate Publication 11 January 2012, doi:10.1042/CBI20110487


© The Author(s) Journal compilation © 2012 International Federation for Cell Biology


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)