| Cancer | ![]() |
Cell death | ![]() |
Cell cycle | ![]() |
Cytoskeleton | ![]() |
Exo/endocytosis | ![]() |
Differentiation | ![]() |
Division | ![]() |
Organelles | ![]() |
Signalling | ![]() |
Stem cells | ![]() |
Trafficking |
|
|
Cell Biology International (2012) 36, 611615 (Printed in Great Britain)
Effect of expansion media containing fibroblast growth factor-2 and dexamethasone on the chondrogenic potential of human adipose-derived stromal cells
Yongxing Liu and Diane R. Wagner1
Graduate Bioengineering Program, The University of Notre Dame, Notre Dame, IN 46556, U.S.A.
hASCs [human ASCs (adipose derived stromal cells)] proliferate more rapidly in the presence of basic FGF-2 (fibroblast growth factor-2) and Dex (dexamethasone). We have examined the effects of expanding hASCs in media containing these two factors on their chondrogenic differentiation potential. Results show that the addition of FGF-2 and Dex to the expansion medium does not remarkably alter the chondrogenic potential of the cells induced by BMP-6 (bone morphogenetic protein-6), based on chondrogenic gene expression, sGAG (sulfated glycosaminoglycan) accumulation and immunohistochemical observation. This is in direct contrast to previously reported promotion of the osteogenic and adipogenic potential of hASCs by these two factors. Therefore, an expansion medium containing FGF-2, with or without Dex, is appropriate for the fast expansion of hASCs without compromising chondrogenic potential. Key words: bone morphogenetic protein-6 (BMP-6), chondrogenic differentiation, dexamethasone (Dex), fibroblast growth factor-2 (FGF-2), human adipose-derived stromal cell (hASC), proliferation Abbreviations: ALP, alkaline phosphatase, ASC, adipose-derived stromal cell, BMP-6, bone morphogenetic protein-6, Dex, dexamethasone, dsDNA, double-stranded DNA, FGF-2, fibroblast growth factor-2, hASC, human ASC, MSC, mesenchymal stromal cell, qRT–PCR, quantitative real–time PCR, sGAG, sulfated glycosaminoglycan, TGFβ, transforming growth factor β 1To whom correspondence should be addressed (email dwagner@nd.edu). 1. Introduction ASCs (adipose derived stromal cells) are a promising cell source for the treatment and regeneration of skeletal tissue defects. In comparison with bone marrow derived MSCs (mesenchymal stromal cells), ASCs have the advantages of abundance and accessibility, while also having significant differentiation potential towards adipogenic, chondrogenic, myogenic and osteogenic lineages (Zuk et al., 2001; Guilak et al., 2010; Locke et al., 2011). Although substantial quantities of ASCs can be harvested from adipose tissue, it is often necessary to propagate the cells to obtain adequate numbers for clinical use. Determining an effective expansion medium for rapid propagation of hASCs (human ASCs) without loss of their multi-differentiation potential is important in the treatment of cartilage defects, which usually requires a large number of cells. FGF-2 (fibroblast growth factor-2) effectively promotes the proliferation of ASCs when added to the expansion media (Chiou et al., 2006; Khan et al., 2008). FGF-2 can selectively propagate the multipotent stem cell subpopulation in bone marrow-derived MSCs and prolong their lifespan by temporarily increasing the telomere size (Bianchi et al., 2003). Dex (dexamethasone) also reportedly speeds up proliferation (Hong et al., 2009; Xiao et al., 2010), inhibits confluence-induced apoptosis (Song et al., 2009), and promotes tri-lineage differentiation of human bone marrow MSCs (Oshina et al., 2007). Moreover, the combination of FGF-2 and Dex in the expansion media synergistically increases hASC proliferation, as well as the subsequent osteogenic and adipogenic differentiation (Lee et al., 2009). However, the chondrogenic response following hASC expansion in the presence of these factors has not been studied. Furthermore, the effect of FGF-2 on chondrogenesis has not been firmly established; while some studies have shown that FGF-2 enhances chondrogenic differentiation of ASCs (Chiou et al., 2006; Khan et al., 2008), others have shown the opposite (Hildner et al., 2010). To address these questions, BMP-6-induced chondrogenesis of hASCs was measured after expansion in media containing Dex and/or FGF-2 or an unsupplemented control medium. The extent of chondrogenic differentiation was assessed by qRT–RCR (quantitative real–time PCR), sGAG (sulfated glycosaminoglycan) quantification and immunohistological examination. To verify that ASCs expanded in these media were differentially driven to the osteogenic lineage, cells were also cultured in osteogenic conditions and ALP (alkaline phosphatase) activity was assessed. 2. Materials and methods 2.1. Cell expansion hASCs were purchased from Zen-Bio Inc. at passage 2 and were expanded for 2 additional passages in 4 different media: (i) control medium, which contained DMEM (Dulbecco's modified Eagle's medium: Mediatech), 10% fetal bovine serum (Atlas Biologics), 100 units/ml penicillin and 100 μg/ml streptomycin (Mediatech), (ii) Dex medium, which consisted of the control medium supplemented with 100 nM Dex (Sigma–Aldrich), (iii) FGF-2 medium, which consisted of the control medium supplemented with 1 ng/ml FGF-2 (Peprotech), and (iv) FGF-2+Dex medium, which consisted of the control medium supplemented with both 100 nM Dex and 1 ng/ml FGF-2. Cells were cultured in a humidified incubator at 37°C and 5% CO2 in air and passaged at subconfluency. Media were replenished every 2–3 days. Cell numbers in each expansion medium after 5 days in culture were counted, normalized to the number seeded and reported relative to the control group (n = 3). 2.2. Chondrogenic differentiation Cells were suspended in 1.2% alginate (Novamatrix) at 6×106 cells/ml. Cell-seeded alginate beads were prepared by ejecting the cell suspension dropwise through a 22-gauge needle mounted on a syringe into a 102 mM CaCl2 solution. The chondrogenic medium consisted of the control medium supplemented with 37.5 μg/ml l-ascorbic acid phosphate magnesium salt (Wako), 1% ITS+ (Becton-Dickinson) and 100 ng/ml BMP-6 (Peprotech) (Estes et al., 2006a; Kemmis et al., 2010), and was replenished every 3–4 days. 2.3. qRT–PCR Total RNA was isolated using RNeasy kit (Qiagen) after hASC expansion in the different media (0 day) and after 21 days of chondrogenic culture in alginate beads (n = 3). cDNA was synthesized using the High Capacity cDNA Reverse Transcription Kit and analysed on a 7500 Fast Real-Time PCR System using Fast SYBR Green Master mix (all from Applied Biosystems). Data from primer sets specific for chondrogenic genes ACAN (forward: GTGCCTATCAGGACAAGGTCT; reverse: GATGCCTTTCACCACGACTTC) and COL2A1 (forward: GGTCTTGGTGGAAACTTTGCT; reverse: GGTCCTTGCATTACTCCCAAC) were normalized against housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase; forward: AGTCCCTGCCCTTTGTACACA; reverse: GATCCGAGGGCCTCACTAAAC). Data were analysed by 2−ΔΔCt method using cDNA from cells prior to exposure to the expansion media as the reference. 2.4. Biochemistry sGAG content was measured after 21 days using a modified DMB (dimethylmethylene blue) assay method (Enobakhare et al., 1996) and normalized to dsDNA (double-stranded DNA) content (Picogreen; Invitrogen), n = 3. 2.5. Immunohistochemistry The 21 day cultures were fixed and processed to obtain 7 μm cryosections. Antigen retrieval was achieved with 0.05% trypsin (Invitrogen) and endogenous peroxidase activity was quenched with 3% H2O2. Primary antibodies raised against aggrecan and type II collagen (both from Santa Cruz Biotechnology) and biotin conjugated secondary antibodies (Jackson ImmunoResearch Laboratories) were applied. Staining was developed using ABC reagent (Pierce) and a diaminobenzidine chromogenic subtrate kit (Pierce). Sections were imaged with a Nikon ME600 microscope equipped with an Optronics digital camera. 2.6. Osteogenic differentiation and alkaline phosphatase staining To confirm the osteogenic capability in hASCs after expansion in the 4 media, cells were cultured in conditions a previously described (Lee et al., 2009). ALP activity, an early marker of osteogenesis, was stained after 7 days with Fast Blue (Malladi et al., 2006). 2.7. Statistical analysis Where applicable, statistical significance was determined by 1- or 2-way ANOVA and Bonferroni post-test (P<0.05) using GraphPad Prism Software. 3. Results The majority of the cells possessed typical fibroblast-like morphology after culturing in monolayer for 5 days in all the media. However, larger cells were more frequently observed in the control and Dex media cultures (Figure 1A), whereas the cells expanded in FGF-2 and FGF-2+Dex medium were more homogenous. Cell numbers in control and Dex media increased comparably (Figure 1B). In contrast, cell numbers in FGF-2 and FGF-2+Dex media increased 1.5–2-fold in comparison with the control respectively. After expansion in the 4 different media, all cultures showed up-regulated chondrogenic genes ACAN and COL2A1 mRNA transcripts in comparison with the cells before expansion (Figure 2A). In particular, ACAN mRNA was up-regulated 40–60-fold. In response to the chondrogenic induction of BMP-6, ACAN and COL2a1 gene were both significantly up-regulated at day 21 in comparison with day 0, but the differences among the pretreatment groups were not significant. Aggrecan and type II collagen were positively stained and homogenously distributed throughout the cryosections in all 4 groups (Figure 2B). No obvious difference was observable in terms of staining intensity or distribution. No significant differences in dsDNA content or sGAG deposition were measured among the 4 groups (data not shown). Although ALP activity was observed in all the osteogenic cultures, a greater percentage of hASCs that were expanded in FGF-2+Dex medium stained positively (Figure 3). This observation is consistent with the study of Lee et al. (2009), which showed 2–5-fold increase of mineral deposition in the osteogenic culture subjected to expansion in FGF-2+Dex-containing medium. 4. Discussion Harvested ASCs comprise a heterogeneous population of unipotent, bipotent and multipotent cells (Guilak et al., 2006). When assessing media that promote ASC expansion, an important consideration is the relative proliferation of the cell types and whether the lineage commitment of the expanded cells is altered by additives and growth factors in the expansion media. Expansion medium containing both FGF-2 and Dex synergistically promotes hASC proliferation and osteogenic and adipogenic differentiation (Lee et al., 2009). Our results suggest that more hASCs may commit to the osteogenic lineage after expansion in FGF-2+Dex medium, and also showed no measureable change to chondrogenic differentiation after expansion in any of the media formulations based on chondrogenic gene expression, sGAG accumulation and immunohistochemical observation. This differential commitment to the distinct lineages indicates that the various cell types of the heterogeneous population may not be equally expanded in the media. However, media containing FGF-2, with or without Dex, is appropriate for hASC expansion for chondrogenic applications, as it induces rapid expansion without compromising chondrogenic potential. While some previous studies have shown that FGF-2 may enhance the chondrogenic differentiation of ASCs (Chiou et al., 2006; Khan et al., 2008), others have shown the opposite (Hildner et al., 2010) and our study found no measureable differences in chondrogenesis. These differing results suggest that further investigation into the effect of FGF-2 on the chondrogenesis of ASCs is warranted. In particular, the interaction of FGF-2 with other growth factors may be critical; Khan et al. (2008) and Chiou et al. (2006) used TGFβ (transforming growth factor β) to induce chondrogenic differentiation, Hildner et al. (2010) used TGFβ in combination with BMP-6, and we used BMP-6 alone. Another potential avenue of investigation is whether the effect of FGF-2 is different when it is added during differentiation as opposed to expansion. Consistent with Khan et al. (2008) and Lee et al. (2009), media supplemented with FGF-2 promoted hASCs proliferation. Increased proliferation in the presence of FGF-2 was correlated with a small spindle-shaped morphology throughout expansion, while some cells without FGF-2 were larger. Cell-size related growth rate was also observed by Estes et al. (2008), who reported a similar effect in hASCs with an expansion medium containing FGF-2, EGF (epidermal growth factor) and TGFβ, which is also supported by observations in other adult stem cells, such as bone marrow MSCs (Sekiya et al., 2002). On the other hand, the addition of Dex did not promote cell proliferation, nor was there a synergistic effect in combination with FGF-2, which is contrary to previous studies using MSCs (Hong et al., 2009; Xiao et al., 2010). This may be attributable to differences in cell type, donor species, or the passage number of the cells. The proliferative effect of Dex was only observed after passage 6 (Xiao et al., 2010), while the cells in the present study were seeded at passage 4. After expansion in each of the 4 media, chondrogenic gene transcription was increased, which is consistent with Estes et al. (2006b). In the previous study, hASCs expression of chondrogenic genes increased with increasing passage numbers in an expansion medium containing FGF-2, though negligible differences in subsequent matrix accumulation were observed. Our results clearly indicate that increase in chondrogenic gene expression is due to time spent in monolayer culture or the passaging of the cells, and is not specific to the additives to the expansion media, as altered gene expression was observed in all 4 media formulations. This is somewhat unexpected, as harvested chondrocytes dedifferentiate in monolayer culture, including a decrease in type II collagen production (Benya and Shaffer, 1982). In conclusion, the present study demonstrates that FGF-2 with or without Dex effectively promotes the propagation of human ASCs in short-term cultures, e.g. 2 passages. The addition of FGF-2 and Dex to the expansion medium does not significantly alter the chondrogenic potential of the cells, based on chondrogenic gene expression, sGAG accumulation and immunohistochemical observation. This expansion medium, therefore, is appropriate for chondrogenic applications of these cells, as the proliferation is enhanced without sacrificing differentiation to the chondrogenic lineage. Author contribution Yongxing Liu was involved in designing the experiments, conducting the research, analysing the data, and writing the manuscript. Diane Wagner contributed to the experimental design, data analysis, and to writing the manuscript. Acknowledgement We thank Khadija Kathiria for her technical assistance. Funding This work was supported by the REFERENCES Benya, PD and Shaffer, JD (1982) Dedifferentiated chondrocytes reexpress the differentiated collagen phenotype when cultured in agarose gels. Cell 30, 215-24 Bianchi, G, Banfi, A, Mastrogiacomo, M, Notaro, R, Luzzatto, L and Cancedda, R (2003) Ex vivo enrichment of mesenchymal cell progenitors by fibroblast growth factor 2. Exp Cell Res 287, 98-105 Chiou, M, Xu, Y and Longaker, MT (2006) Mitogenic and chondrogenic effects of fibroblast growth factor-2 in adipose-derived mesenchymal cells. Biochem Biophys Res Commun 343, 644-52 Enobakhare, BO, Bader, DL and Lee, DA (1996) Quantification of sulfated glycosaminoglycans in chondrocyte/alginate cultures, by use of 1,9-dimethylmethylene blue. Anal Biochem 243, 189-91 Estes, BT, Wu, AW and Guilak, F (2006a) Potent induction of chondrocytic differentiation of human adipose-derived adult stem cells by bone morphogenetic protein 6. Arthritis Rheum 54, 1222-32 Estes, BT, Wu, AW, Storms, RW and Guilak, F (2006b) Extended passaging, but not aldehyde dehydrogenase activity, increases the chondrogenic potential of human adipose-derived adult stem cells. J Cell Physiol 209, 987-95 Estes, BT, Diekman, BO and Guilak, F (2008) Monolayer cell expansion conditions affect the chondrogenic potential of adipose-derived stem cells. Biotechnol Bioeng 99, 986-95 Guilak, F, Estes, BT, Diekman, BO, Moutos, FT and Gimble, JM (2010) 2010 Nicolas Andry Award: Multipotent adult stem cells from adipose tissue for musculoskeletal tissue engineering. Clin Orthop Relat Res 468, 2530-40 Guilak, F, Lott, KE, Awad, HA, Cao, Q, Hicok, KC and Fermor, B (2006) Clonal analysis of the differentiation potential of human adipose-derived adult stem cells. J Cell Physiol 206, 229-37 Hildner, F, Peterbauer, A, Wolbank, S, Nurnberger, S, Marlovits, S and Redl, H (2010) FGF-2 abolishes the chondrogenic effect of combined BMP-6 and TGF-beta in human adipose derived stem cells. J Biomed Mater Res A 94, 978-87 Hong, L, Sultana, H, Paulius, K and Zhang, G (2009) Steroid regulation of proliferation and osteogenic differentiation of bone marrow stromal cells: a gender difference. J Steroid Biochem Mol Biol 114, 180-5 Kemmis, CM, Vahdati, A, Weiss, HE and Wagner, DR (2010) Bone morphogenetic protein 6 drives both osteogenesis and chondrogenesis in murine adipose-derived mesenchymal cells depending on culture conditions. Biochem Biophys Res Commun 401, 20-5 Khan, WS, Tew, SR, Adesida, AB and Hardingham, TE (2008) Human infrapatellar fat pad-derived stem cells express the pericyte marker 3G5 and show enhanced chondrogenesis after expansion in fibroblast growth factor-2. Arthritis Res Ther 10, R74 Lee, SY, Lim, J, Khang, G, Son, Y, Choung, PH and Kang, SS (2009) Enhanced ex vivo expansion of human adipose tissue-derived mesenchymal stromal cells by fibroblast growth factor-2 and dexamethasone. Tissue Eng Part A 15, 2491-99 Locke, M, Feisst, V and Dunbar, PR (2011) Concise review: human adipose-derived stem cells (ASC): separating promise from clinical need. Stem Cells 29, 404-11 Malladi, P, Xu, Y, Chiou, M, Giaccia, AJ and Longaker, MT (2006) Effect of reduced oxygen tension on chondrogenesis and osteogenesis in adipose-derived mesenchymal cells. Am J Physiol Cell Physiol 290, C1139-46 Oshina, H, Sotome, S, Yoshii, T, Torigoe, I, Sugata, Y and Maehara, H (2007) Effects of continuous dexamethasone treatment on differentiation capabilities of bone marrow-derived mesenchymal cells. Bone 41, 575-83 Sekiya, I, Larson, BL, Smith, JR, Pochampally, R, Cui, JG and Prockop, DJ (2002) Expansion of human adult stem cells from bone marrow stroma: conditions that maximize the yields of early progenitors and evaluate their quality. Stem Cells 20, 530-41 Song, IH, Caplan, AI and Dennis, JE (2009) Dexamethasone inhibition of confluence-induced apoptosis in human mesenchymal stem cells. J Orthop Res 27, 216-21 Xiao, Y, Peperzak, V, van Rijn, L, Borst, J and de Bruijn, JD (2010) Dexamethasone treatment during the expansion phase maintains stemness of bone marrow mesenchymal stem cells. J Tissue Eng Regen Med 4, 374-86 Zuk, PA, Zhu, M, Mizuno, H, Huang, J, Futrell, JW and Katz, AJ (2001) Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng 7, 211-28 Received 11 September 2011/18 January 2012; accepted 15 February 2012 Published as Cell Biology International Immediate Publication 15 February 2012, doi:10.1042/CBI20110503 © The Author(s) Journal compilation © 2012 International Federation for Cell Biology |
ISSN Print: 1065-6995
ISSN Electronic: 1095-8355 Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB) |