| Cancer | ![]() |
Cell death | ![]() |
Cell cycle | ![]() |
Cytoskeleton | ![]() |
Exo/endocytosis | ![]() |
Differentiation | ![]() |
Division | ![]() |
Organelles | ![]() |
Signalling | ![]() |
Stem cells | ![]() |
Trafficking |
|
|
Cell Biology International (2012) 36, 653659 (Printed in Great Britain)
Anti-miR-155 oligonucleotide enhances chemosensitivity of U251 cell to taxol by inducing apoptosis
Wei Meng*, Ling Jiang†, Lin Lu‡, Haiyan Hu§, Hailang Yu*, Dapeng Ding*, Kun Xiao¶, Wenling Zheng*, Hongbo Guo‖1 and Wenli Ma*1
*Institute of Genetic Engineering, Southern Medical University, Guangzhou, Peoples Republic of China, †Department of Hematology, Nanfang Hospital, Southern Medical University, Guangzhou, Peoples Republic of China, ‡Department of Obstetrics and Gynecology, Nanfang Hospital, Southern Medical University, Guangzhou, Peoples Republic of China, §Department of Hematology, Zhujiang Hospital, Southern Medical University, Guangzhou, Peoples Republic of China, ¶Department of Epidemiology, Mailman School of Public Health, Columbia University Medical Center, New York, NY 10032, U.S.A., and ‖Department of Neurosurgery, Institute of Neuroscience, Key Laboratory of Guangdong province, Zhujiang Hospital Southern Medical University, Guangzhou, Peoples Republic of China
The oncogene, microRNA-155, is significantly elevated in GBM (glioblastoma multiforme), regulating multiple genes associated with cancer cell proliferation, apoptosis and invasiveness. Thus, miR-155 can theoretically become a target for enhancement of the chemotherapy in cancer. Down-regulating miR-155 to enhance the effect of taxol has not been studied in human GBM. Human GBM U251 cells were treated with taxol and the miR-155 inhibitor alone or in combination. IC50 values were dramatically decreased in cells treated with miR-155 inhibitor combined with taxol, to a greater extent than those treated with taxol alone. Furthermore, the miR-155 inhibitor significantly enhanced apoptosis in U251 cells. The data suggest that miR-155 blockage increased the chemosensitivity to taxol in GBM cells, making combined treatment an effective therapeutic strategy for controlling the growth by inhibiting EAG1 expression. Key words: apoptosis, glioblastoma multiforme (GBM), miR-155, taxol, U251 cell Abbreviations: DMEM, Dulbecco's modified Eagle's medium, FBS, foetal bovine serum, GBM, glioblastoma multiformes, miRNAs, microRNAs, MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide, RT, reverse-transcriptase 1To whom correspondence should be addressed (email Mengwei_126@126.com). 1. Introduction Chemotherapeutic drugs are responsible for most cases of adjuvant treatment in patients with GBMs (glioblastoma multiformes) after surgical procedures. Attention is being focused on the use taxol in glioma, both in experimental studies and clinical trails (Karmakar et al., 2007). However, the median overall survival has not increased in patients treated with concurrent chemoradiotherapy. Consequently, further studies of procedures that could enhance the therapeutic effect of taxol are being sought. Compelling evidence (Moos and Fitzpatrick, 1998) indicates that taxol kills cancer cells through the induction of apoptosis. Taxol-treated cells show defects in mitotic spindle assembly, chromosome segregation and cell division. Unlike other tubulin-targeted drugs, such as colchicine that inhibits microtubule assembly, taxol stabilizes the microtubules and protects them from disassembly. The inability of the chromosomes to achieve a metaphase spindle configuration blocks mitosis, in which there is prolonged activation of the mitotic checkpoint with the subsequent triggering of apoptosis or slippage back into the G1-phase of the cell cycle without cell division. (Bharadwaj and Yu, 2004; Brito et al., 2008). The ability of taxol to inhibit spindle function is generally attributed to its suppression of microtubule dynamics. (Jordan and Leslie, 2004). The presence of voltage-gated ion channels in tumour cells was considered to be an epiphenomenon of malignant transformation. The first indication of the potential relevance of this class of molecules was the demonstration that they participate in proliferation (DeCoursey et al., 1984). It has since been increasingly documented that ion channels, and in particular potassium channels, are implicated in carcinogenesis and tumour progression (Conti, 2004; Kunzelmann, 2005; Pardo et al., 2005; Camacho et al., 2006; Felipe et al., 2006; Stühmer et al., 2006; Le Guennec et al., 2007; Villalonga et al, 2007). This paper is focused on a particular voltage-gated potassium selective channel Eag1 that may be useful in the management of cancer. miRNAs (microRNAs) are a class of endogenous RNA molecules of 19–25 nucleotides in length that induce mRNA degradation, translational repression, or both, via pairing with partially complementary sites in the 3′ UTR (untranslated region) of the targeted genes (Griffiths-Jones et al., 2006). There are >600 miRNAs estimated in humans (Yu et al., 2007) and 30% of all genes are regulated by miRNAs (Bartel, 2004). Five miRNAs are strongly implicated in such processes as development and differentiation, carcinogenesis, cell survival and apoptosis (Harfe, 2005; Blower et al., 2008). miRNAs may have an effect on the chemosensitivity or chemoresistance of cancer cells (Oberti et al., 2006; Xia et al., 2008; Zhu et al., 2008). In this study, we have explored whether down-regulating miR-155 enhances the chemotherapeutic effect of taxol on human glioblastoma U251 cells. 2. Materials and methods 2.1. Cell lines and transfection Human glioma cell line, U251, was purchased from the Chinese Academy of Sciences Cell Bank. They were maintained at 37°C under 5% CO2 (v/v) in air in DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% FBS (foetal bovine serum, v/v), and routinely passaged at 2–3 day intervals. When 80% confluent, they were placed in DMEM with 1% FBS for 24 h and maintained in this low serum condition for the course of all treatments. Cells in the exponential phase of growth were seeded in 96 or 24well plates and transfected with oligo-deoxynucleotides using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, U.S.A.) in serum-free DMEM for 6 h. Transfection complexes were prepared according to the manufacturer's instructions. The cells were incubated in medium containing 10% FBS after transfection. 2.2. Design and synthesis of miR-155 inhibitor sequences The sequences of anti-miRNA oligonucleotides were designed according to the principle of sequences complementary to mature mRNA. The oligodeoxynucleotide sequences used were: miR-155 inhibitor: 5′-ACCCCUAUCACGAUUAGCAUUAA-3′ (23 bp); mir-155 mimics: sense (5′–3′) 5′- UUAAUGCUAAUCGUGAUAGGGGU -3′ (23 bp) and antisense(5′–3′) 5′-CCCUAUCACGAUUAGCAUUAAUU-3′. All oligodeoxynucleotides were chemically synthesized, modified with phosphorothioate by the Shanghai GenePharma Co., Ltd. (Shanghai, China) and stored at −20°C. 2.3. Quantitative real-time PCR of miR-155 and EAG1 expression U251 cells were transfected with 0.4 μM oligonucleotides using the Lipofectamine 2000 reagent for 48 h. The same process was followed as described above. miR-155 and U6 snRNA levels were determined by the miRNAs RT (reverse-transcriptase)-PCR Quantitation Kit (Shanghai GenePharma Company, Shanghai, China). U6 snRNAs were used as the internal control. The fold change for miR-155 expression level was calculated using the 2−ΔΔCt method. The total RNA from treated cells was extracted in Trizol (Invitrogen) and quantified by an ultraviolet spectrophotometer (UVP Inc., Upland, CA, U.S.A.) at 260 nm. The miRNs real-time PCR Quantitation Kit had two steps: RT-PCR and real-time PCR. The stemloop RT primer was hybridized to a miRNA molecule and then reverse transcribed with an MMLV reverse transcriptase. The RT products were then quantified using conventional TaqMan PCR (Bio-Rad Laboratories, Inc.). A 20 ml RT reaction was incubated at 25°C for 30 min, and the reaction mixture was incubated at 94°C for 3 min. The reaction was repeated for 45 cycles; each cycle consisted of denaturing at 94°C for 20 s, with annealing at 50°C for 25 s, and synthesis at 72°C for 20 s. U6 snRNA was used as an internal control. EAG1 mRNAs were determined by SYBR-Green real-time PCR assay conducted with 40 cycles of 10 s at 95°C, 30 s at 60°C, and 45 s at 72°C. Melting curve analysis was performed, with EAG1 mRNAs being normalized to GAPDH. 2.3. Cell viability assay Cell viability was determined by the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide] assay. Briefly, 104 cells/well were seeded in 96-well plates and allowed to attach overnight. The concentrations of free-taxol and miR-155 inhibitor were 6 mg/l and 0.4 μmol/l, respectively. Each group contained 8 wells. On each of 5 consecutive days, 20 μl of MTT (0.5 mg/ml) was added to each well and the cells were incubated at 37°C for 4 h. The reaction was stopped by lysing the cells with 200 μl of DMSO (dimethyl sulfoxide) for 15 min. Quantification measurements (optical density) were obtained at 570 nm by spectrophotometric analysis. IC50 values were calculated from the linear regression line of the plot of percentage inhibition versus log inhibitor concentration. 2.4. Evaluation of cell apoptosis To quantify drug-induced apoptosis, cells were stained with annexin V/PI, and apoptosis was measured by flow cytometric analysis. Briefly, after treatment with the miR-155 inhibitor and the taxol, both floating and attached cells were collected and subjected to annexin V/PI staining using an annexin V-FITC Apoptosis Detection Kit (BioVision, Palo Alto, CA, U.S.A.). Fluorescence was measured with a FACS flowcytometer (Becton Dickinson, San Jose, CA, U.S.A.). 2.5. Western blot analysis Cells were lysed in RIPA buffer in the presence of proteinase inhibitor (Shanghai Shenergy Biocolor BioScience & Technology Company, Shanghai, China). Protein concentration was determined by BCA (Bios, Beijing, China). Aliquots (25 mg) were separated on 10% SDS/PAGE (w/v) and transferred to nitrocellulose membrane. Membranes were probed with primary antibodies against EAG1 (rabbit polyclonal; Cell Biotech, Tianjin, China) at room temperature for 2 h, washed extensively with 0.1% Tween-20 (v/v) in phosphate-buffered saline and incubated with secondary antibodies conjugated with horseradish peroxidase at 1: 1000 dilution. The signals were visualized with diaminobenzidine. 3. Results 3.1. miR-155 expression in U251 cells treated with combination therapy Regulation of miR-155 by the inhibitor and MIMIC was verified by QRT (quantitative reverse transcription)-PCR (Figure 1). Taxol alone also down-regulated miR-155 expression. The lowest level of miR-155 expression was achieved by treatment with the miR-155 inhibitor in combination with taxol therapy. 3.2. miR155 inhibitor promotion of chemosensitivity of U251 cells miR-155 inhibitor alone effectively inhibited cell viability significantly (P<0.01, compared with controls; Figure 2). miR-155 inhibitor also increased the inhibitory effects of taxol on U251 cells (P<0.01, compared with SCR/taxol control). The taxol IC50 of U251 cells is 416 nmol/l; whereas, in combination with the miR-155 inhibitor (20 μmol/l) the IC50 was 52 nmol/l, and with the miR-155 MIMIC the IC50 was 524 nmol/l. Analysis with SPSS software demonstrates statistically significant differences between any of the single drug treatments and the combination treatment. 3.3. miR-155 inhibitor down-regulation of EAG1 mRNA and protein levels The effects of miR-155 inhibitor on EAG1 mRNA and protein levels in U251 cells transfected with miR-155 inhibitor and MIMIC were analysed for EAG1 mRNA (SYBR-Green real-time PCR) and EAG1 protein (Western blotting) The concentration of free-taxol was 6 mg/l. The miR-155 inhibitor effectively down-regulated EAG1 mRNA (Figure 3A) and protein levels (Figure 3B) in U251 cells. 3.4. miR-155 inhibitor induction of U251 cell apoptosis Apoptotic U251 cells were detected by double staining with annexin V and PI. miR-155 inhibitor alone induced cell apoptosis (P<0.01 compared with controls), and enhanced apoptosis of cells induced by taxol (P<0.01; Figure 4). Double stained images are shown in Figure 4B. 4. Discussion Cancer drug resistance is a multifactorial phenomenon involving several major mechanisms, such as increased repair of DNA damage, reduced apoptosis, altered metabolism of drugs and greater energy-dependent efflux of chemotherapeutic drugs that diminish the ability of cytotoxic agents to kill cancer cells (Ga et al., 2008). MiRNA expression affecting multiple genes simultaneously provided support for this hypothesis. This is evidence from (a) the down-regulation of miR-451 leading to increased metabolism of DOX (Yu-Zhuo et al., 2009); (b) down-regulation of miR-328 resulting in increased mitoxantrone sensitivity (Tyler et al., 2008); and (c) overexpression of miR-221 and miR-222 in MCF-7 cells conferring resistance to tamoxifen (Fraser et al., 2003). These finding support the hypothesis that correction of altered expression of miRNA might have significant implications for therapeutic strategies that overcome resistance. The amount of apoptosis of cancer cells is pivotal in their responses to chemotherapeutic agents. (Esquela-Kerscher and Slack 2006). Our novel finding is that knockdown of miR-115 expression by miR-155 inhibitor sensitizing human glioma cells to the anticancer drug, taxol. MiR-155 was first implicated as an anti-apoptotic factor because knockdown of miR-155 increased apoptosis in human glioblastoma cells. Despite the well-established role of miR-155 in GBM, the molecular mechanism of miR-155 suppression in GBM chemotherapy was largely unexplored. The balance between proapoptotic and antiapoptotic proteins may determine the level of cell death and survival by controlling apoptosis. (Oltvai et al., 1993; Amundson et al., 2000). Many cytotoxic antitumour drugs in clinical use exert their antitumour activity by inducing apoptosis. (Reed et al., 2003) Consequently, the development of resistance of tumour cells to cytotoxic drugs may be due to suppression of apoptosis. Many tumours can escape apoptosis signals by expressing anti-apoptotic proteins, e.g. Bcl-2 (Pardo et al., 1999; Bettaieb et al., 2003). In vitro sequence-specific functional inhibition of miR-155 in U251 cells leads to increased caspase levels, followed by cell death. Both miR-155 knockdown and taxol treatment alone depressed viability and caused caspase-3 up-regulation in both cell lines, implicating apoptosis to be involved as a cell death mechanism. (Moos and Fitzpatrick, 1998; Park, 2008). This indicate that, at least in vitro, knockdown of miR-155 before taxol administration sensitizes U251cells for taxol cytotoxicity (Figure 4D). Although these effects of AMO-miR-155 cannot be attributed completely to the down-regulation of target EAG1, it seems to be partially relevant to EAG1. Several studies implicating ectopic expression of Eag1 in many cancer cell lines and primary tumours (Pardo et al., 1999; Ouadid-Ahidouch et al., 2001; Stuhmer et al., 2006; Weber et al., 2006), EAG1 inhibition of the channel expression and/or function reduces tumour progression (Gavrilova-Ruch et al., 2002; Farias et al., 2004). Current therapy for malignant gliomas needs to seek novel targets and more effective, less toxic therapeutic strategies. Our data provide new rationales for novel combinational therapies using an miR-155 inhibitor that synergistically cooperates with taxol. We still do not understand the mechanism responsible for the high frequency of aberrant expression of the channel, but it is generally accepted that Eag1 expression provides a selective advantage to tumour cells. In heterologous systems, the electrophysiological properties of Eag1 depend on the cell cycle stage of the cells (Brüggemann et al., 1997; Pardo et al., 1998), to the point that the selectivity of the channel changes, probably depending on the cytoskeletal rearrangement during cytokinesis (Camacho et al., 2000). Reciprocally, Eag1 appears to be involved in cell cycle (Borowiec et al., 2007); cells expressing Eag1 grow faster than control cells, and inhibition of Eag1 expression reduces cell proliferation (Borowiec et al., 2007). A mechanism for the AMO-miR-155 inhibitory effects mainly promoted apoptosis in U251 cells has been elucidated. Therefore, AMO-miR-155 might be strong apoptotic activator in U251 cells. AMO-miR-155 down-regulation of EAG1 expression is possibly due to the degradation of miR-155, although this has not been shown. 5. Conclusions In U251 cell line, miR-155 suppression increases their chemosensitivity to taxol. The miR-155 inhibitor, but only additively, interacted with taxol on U251 cells, possibly by interrupting the activity of EAG1 pathways. It enhanced chemosensitivity of human glioblastoma cells to taxol, making a combination of the inhibitor and taxol an effective therapeutic strategy for suppressing the growth of U251 cells. Author contribution Hongbo Guo and Wenli Ma conceived the idea and obtained funding. Wei Meng was in charge of the whole experiment. Ling Jiang, Lin Lu, Haiyan Hu, Hailang Yu, Dapeng Ding, Kun Xiao and Wenling Zheng wrote and revised the paper and prepared the Figures. Funding This work was supported by the REFERENCES Amundson, SA, Myers, TG, Scudiero, DS, Kitada, S, Reed, JC and Fornace, AJ Jr (2000) An informatics approach identifying markers of chemosensitivity in human cancer cell lines. Cancer Res 60, 6101-10 Bartel, DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281-97 Bettaieb, A, Dubrez-Daloz, L, Launay, S, Plenchette, S, Rébé, C and Cathelin, S (2003) Bcl-2 proteins: targets and tools for chemosensitisation of tumor cells. Curr Med Chem Anticancer Agents 3, 307-18 Bharadwaj, R and Yu, H (2004) ‘The spindle checkpoint, aneuploidy, and cancer’. Oncogene 23, 2016-27 Blower, PE, Chung, JH and Verducci, JS (2008) MicroRNAs modulate the chemosensitivity of tumor cells. Mol Cancer Ther 7, 1-9 Borowiec, AS, Hague, F, Harir, N, Guénin, S, Guerineau, F and Gouilleux, F (2007) IGF-1 activates hEAG K(+) channels through an Akt-dependent signaling pathway in breast cancer cells: role in cell proliferation. J Cell Physiol 212, 690-701 Brito, DA, Yang, Z and Rieder, CL (2008) ‘Microtubules do not promote mitotic slippage when the spindle assembly checkpoint cannot be satisfied’. J. Cell Biol 182623-9 Brüggemann, A, Stühmer, W and Pardo, LA (1997) Mitosis-promoting factor-mediated suppression of a cloned delayed rectifier potassium channel expressed in Xenopus oocytes. Proc Natl Acad Sci USA 94, 537-42 Camacho, J, Sánchez, A, Stühmer, W and Pardo, LA (2000) Cytoskeletal interactions determine the electrophysiological properties of human EAG potassium channels. Pflugers Arch 441, 167-74 Camacho, J (2006) Ether a go-go potassium channels and cancer. Cancer Lett 233, 1-9 Conti, M (2004) Targeting K+ channels for cancer therapy. J Exp Ther Oncol 4, 161-66 DeCoursey, TE, Chandy, KG, Gupta, S and Cahalan, MD (1984) Voltage-gated K+ channels in human T lymphocytes: a role in mitogenesis. Nature 307, 465-8 Esquela-Kerscher, A and Slack, FJ (2006) Oncomirs-microRNAs with a role in cancer. Nat Rev Cancer 6, 259-69 Farias, LMB, Bermúdez Ocaña, D, Díaz, L, Larrea, F, Avila-Chávez, E and Cadena, A (2004) Ether à go-go potassium channels as human cervical cancer markers. Cancer Res 64, 6996-7001 Felipe, A, Vicente, R, Villalonga, N, Roura-Ferrer, M, Martínez-Mármol, R and Solé, L (2006) Potassium channels: new targets in cancer therapy. Cancer Detect Prev 30, 375-85 Fraser, M, Leung, BM, Yan, X, Dan, HC, Cheng, JQ and Tsang, BK (2003) p53 is a determinant of X-linked inhibitor of apoptosis protein/Akt-mediated chemoresistance in human ovarian cancer cells. Cancer Res 63, 7081-8 Ga, K, Jody, F and James, M (2008) Involvement of microRNA-451 in resistance of MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther 7, 2152-9 Gavrilova-Ruch, O, Schönherr, K, Gessner, G, Schönherr, R, Klapperstück, T, Wohlrab, W and Heinemann, SH (2002) Effects of imipramine on ion channels and proliferation of IGR1 melanoma cells. J Membr Biol 188, 137-49 Griffiths-Jones, S, Grocock, RJ and van Dongen, S (2006) miRBase:microRNA sequences, targets and gene nomenclature. Nucleic Acids Res 34, 140-4 Harfe, BD (2005) MicroRNAs in vertebrate development. Curr Opin Genet Dev 15, 410-5 Jordan, MA and Leslie, W (2004) Microtubules as a target for anticancer drugs. Nat Rev Cancer 4, 253-65 Karmakar, S, Banik, NL, Patel, SJ and Ray, SK (2007) Combination of all- trans retinoic acid and taxol regressed glioblastoma T98G xenografts in nude mice. Apoptosis 12, 2077-87 Kunzelmann, K (2005) Ion channels and cancer. J Membr Biol 205, 159-73 Le Guennec, JY, Ouadid-Ahidouch, H, Soriani, O, Besson, P, Ahidouch, A and Vandier, C (2007) Voltage-gated ion channels, new targets in anti-cancer research. Recent Patents Anticancer Drug Discov 2, 189-202 Moos, PJ and Fitzpatrick, FA (1998) Taxane-mediated gene induction is independent of microtubule stabilization: induction of transcription regulators and enzymes that modulate inflammation and apoptosis. Proc Natl Acad Sci USA 95, 3896-901 Oberti, A, La Sala, D and Cinti, C (2006) Multiple genetic and epigenetic interacting mechanisms contributes to clonally selection of drug-resistant tumors: current views and new therapeutic prospective. J Cell Physiol 207, 571-81 Oltvai, ZN, Milliman, CL and Korsmeyer, SJ (1993) Bcl-2 heterodimerizes in vivo with a conserved homolog, bax, that accelerates programmed cell death. Cell 74, 609-19 Ouadid-Ahidouch, H, Le Bourhis, X, Roudbaraki, M, Toillon, RA, Delcourt, P and Prevarskaya, N (2001) Changes in the K+ current-density of MCF-7 cells during progression through the cell cycle: possible involvement of a h-ether.a-gogo K+ channel N. Recept Channels 7, 345-56 Pardo, LA, Brüggemann, A, Camacho, J and Stühmer, W (1998) Cell cycle-related changes in the conducting properties of r-eag K+ channels. J Cell Biol 143, 767-75 Pardo, LA, Contreras-Jurado, C, Zientkowska, M, Alves, F and Stühmer, W (2005) Role of voltage-gated potassium channels in cancer. J Membr Biol 205, 115-24 Pardo, LA, del Camino, D, Sánchez, A, Alves, F, Brüggemann, A and Beckh, S (1999) Oncogenic potential of EAG K(+) channels W. EMBO J. 18, 5540-7 Park, SM and Peter, ME (2008) microRNAs and death receptors. Cytokine Growth Factor Rev 19, 303-11 Reed, JC (2003) Apoptosis-targeted therapies for cancer. Cancer Cell 3, 17-22 Stühmer, W, Alves, F, Hartung, F, Zientkowska, M and Pardo, LA (2006) Potassium channels as tumour markers. FEBS Lett 580, 2850-2 Tyler, EM, Kalpana, G and Bhuvaneswari, R (2008) MicroRNA-221/222 confers tamoxifen resistance in breast cancer by targeting p27kip1. J Biol Chem 283, 29897-903 Villalonga, N, Ferreres, JC, Argiles, JM, Condom, E and Felipe, A (2007) Potassium channels are a new target field in anticancer drug design. Recent Patents Anticancer Drug Discov 2, 212-23 Weber, C, Mello de Queiroz, F, Downie, BR, Suckow, A, Stühmer, W and Pardo, LA (2006) Silencing the activity and proliferative properties of the human Eag1 potassium channel by RNAi. J Biol Chem 281, 13033-7 Xia, L, Zhang, D, Du, R, Pan, Y, Zhao, L and Sun, S (2008) miR-15b and miR-16 modulate multidrug resistance by targeting BCL2 in human gastric cancer cells. Int J Cancer 123, 372-9 Yu, ZB, Jian, ZF and Shen, SH (2007) Global analysis of microRNA targetgene expression reveals that miRNA targets are lower expressed immature mouse and Drosophila tissues than in the embryos. Nucleic Acids Res 35, 152-64 Yu-Zhuo, P, Marilyn, EM and Ai-ming, Y (2009) MicroRNA-328 negatively regulates the expression of breast cancer resistance protein (BCRP/ABCG2) in human cancer cells. Mol Pharmacol 75, 1374-9 Zhu, H, Wu, H, Liu, X, Evans, BR, Medina, DJ and Liu, CG (2008) MiR-27a and miR-451 in the regulation of MDR1/P-glycoprotein expression in human cancer cells. Biochem Pharmacol 76, 582-8 Received 28 December 2010/11 September 2011; accepted 26 January 2012 Published as Cell Biology International Immediate Publication 26 January 2012, doi:10.1042/CBI20100918 © The Author(s) Journal compilation © 2012 International Federation for Cell Biology |
ISSN Print: 1065-6995
ISSN Electronic: 1095-8355 Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB) |