| Cancer | ![]() |
Cell death | ![]() |
Cell cycle | ![]() |
Cytoskeleton | ![]() |
Exo/endocytosis | ![]() |
Differentiation | ![]() |
Division | ![]() |
Organelles | ![]() |
Signalling | ![]() |
Stem cells | ![]() |
Trafficking |
|
|
Cell Biology International (2012) 36, 661667 (Printed in Great Britain)
Overexpression of the gap junction protein Cx43 as found in diabetic foot ulcers can retard fibroblast migration
Ariadna Mendoza‑Naranjo*1, Peter Cormie*1, Antonio E. Serrano*, Chuihui M. Wang*, Christopher Thrasivoulou*, Jessica E.S. Sutcliffe*, Daniel J. Gilmartin*, Janice Tsui†, Thomas E. Serena‡, Anthony R.J. Phillips§ and David L. Becker*2
*Department of Cell and Developmental Biology, University College London, Gower Street, London, WC1E 6BT, U.K., †Department of General Surgery, University College London, Gower Street, London, WC1E 6BT, U.K., ‡311 Pennsylvania Avenue West, Warren, PA 16365, U.S.A., and §CoDa Therapeutics Inc, 111 Jervois Road, Herne Bay, Auckland, New Zealand
Poor healing of DFUs (diabetic foot ulcers) is a major clinical problem that can be extremely debilitating and lead to lower limb amputation. In the normal acute wound, the Cx43 (connexin 43) gap junction protein is down-regulated at the wound edge as a precursor to cell migration and healing. In fibroblasts from the human chronic DFU wound edge there was a striking and significant 10-fold elevation of Cx43 protein, as well as a 6-fold increase in N-cadherin and a 2-fold increase in ZO-1 (zonular occludin-1), compared with unwounded skin. In streptozotocin diabetic rats, Cx43 was found to be up-regulated in intact dermal fibroblasts in direct proportion to blood glucose levels and increased 2-fold further in response to wounding of the skin. To mimic diabetes, NIH 3T3 fibroblasts were cultured under different concentrations of glucose or mannitol and Cx43 protein intercellular communication and migration rates were determined. Cultures of fibroblasts in very high (40 mM) glucose conditions showed significantly elevated Cx43 protein levels, as shown by immunostaining and Western blotting, and significantly increasing gap junctional communication, as shown by dye transfer. In scratch wound-healing assays, increased levels of Cx43 from high glucose resulted in repressed filopodial extensions and significantly slower migration rates than in either standard conditions (5.5 mM glucose) or the osmotic control of mannitol. Conversely, when glucose-induced Cx43 up-regulation was prevented with Cx43shRNA (Cx43 short-hairpin RNA) transduction, the fibroblasts extended long filopodia and migrated significantly faster. Cx43 protein was up-regulated in fibroblasts in DFUs as well as after high glucose exposure in culture which correlated with inhibition of fibroblast migration and is likely to contribute to impaired wound healing. Key words: antisense, chronic wound, Connexin 43, diabetic foot ulcer, migration, wound healing Abbreviations: Cx43, connexin 43, Cx43shRNA, Cx43 short-hairpin RNA, DFU, diabetic foot ulcer, FGF, fibroblast growth factor, GAP27, GTPase-activating protein 27, p.Sup, pSuppressor, STZ, streptozotocin, ZO-1, zonular occludin-1 1These authors equally contributed to this work. 2To whom correspondence should be addressed (email d.becker@ucl.ac.uk). 1. Introduction People with diabetes can have wounds that heal poorly and suffer a high incidence of non-healing skin ulcers (Dinh and Veves, 2005). These ulcers, most frequently found on the feet, can be extremely debilitating and a significant number eventually lead to lower limb amputations (Dinh and Veves, 2005). The incidence of diabetes in the worldwide population is increasing at an alarming rate and consequently the incidence of diabetic ulcers and their complications is also on the rise. These wounds are expensive to manage and often respond poorly to current interventions, representing a burgeoning clinical burden for health services worldwide (Mustoe, 2004). The gap junction protein Cx43 (Connexin 43) plays a central role in the wound healing response (Coutinho et al., 2003; Kretz et al., 2003; Qiu et al., 2003; Mori et al., 2006; Kandyba et al., 2008, Wright et al., 2009). In wound-edge keratinocytes Cx43 normally down-regulates in the first 24–48 h as they become migratory and crawl forward to heal the wound (Goliger and Paul, 1995; Coutinho et al., 2003). An accelerated transition to the migratory state in rodents has been shown when Cx43 is more rapidly down-regulated by application of a Cx43 specific antisense gel to the wound (Qiu et al., 2003; Mori et al., 2006). In contrast, the Cx43 protein in STZ (streptozotocin) diabetic rats is abnormally overproduced in wound-edge keratinocytes after wounding and migration fails to occur until it is reduced (Wang et al., 2007). Cx43 was also reported to be detected in cells at the wound margins of the majority of biopsies taken from nine mixed and two diabetic leg ulcers (Brandner et al., 2004). We believe abnormal Cx43 protein expression may in part underpin the poor healing observed in diabetic skin ulcers. It is of note that recovery of normal migratory rates of keratinocytes in STZ diabetic rats can be achieved by the application of Cx43 antisense to wounds, a treatment that prevents the abnormal elevation of Cx43 (Wang et al., 2007). In diabetic chronic wound healing, one of the key problems is the failure of fibroblasts to migrate out into the wound bed and form new granulation tissue (Mustoe, 2004, Wall et al., 2008). Cx43 expression in human and diabetic rat wound-edge fibroblasts has not previously been described; although Cx43 was reported to be significantly elevated in intact diabetic rat dermis where intercellular communication was also increased (Wang et al., 2007). Human diabetic fibroblasts have also been reported to have elevated gap junctional communication (Abdullah et al., 1999) and retarded proliferation (Loots et al., 1999). We have quantified the dermal Cx43 protein in intact human skin biopsies taken from normoglycaemic donors, and from forearm and ulcer wound-edge biopsies in patients with confirmed diabetes. Complementary in vivo and in vitro studies examined the effects of elevated glucose on Cx43 protein levels, gap junctional communication and migration in a scratch wound-healing assay as well as the contribution of Cx43 protein levels to the rate of migration. 2. Materials and methods 2.1. Human skin biopsies The collection of 4 mm punch biopsies from the edges of chronic DFUs (diabetic foot ulcers) was approved by the Western Institutional Review Board, Olympia, Washington State, U.S.A. This sample was taken from the ulcer wound edge as well as a matched forearm biopsy of unwounded skin. A separate non-diabetic cohort had a biopsy of forearm skin. All biopsies were taken after written informed consent was obtained. The diabetic cohort comprised ten Caucasian subjects (six males and four females) with median age 59.5 years (range: 48–82 years). Nine subjects were on insulin and one on oral medication, with the cohort median HbA1c (glycated Hb) 6.9 (range 5.3–9.9; n = 6 available). All had diabetic neuropathy of the extremities and six had clinical indications of peripheral vascular disease. Each subject had a clinically confirmed DFU. Median ulcer size 9.4 cm2 (1–81 cm2) with a duration median of 3.5 months (range 1.5–26 months). The control cohort of non-diabetic intact skin arm biopsies was taken from Caucasian individuals, comprising six subjects of median age 48.5 years (two males and four females; range 36–79 years). 2.2. Diabetic rats Home Office approval was obtained for all animal work. Diabetes was induced in male Sprague–Dawley rats (350–400 g) by intraperitoneal injection of STZ (65 mg/kg) and diabetes confirmed using glucose urinary strips (Clinistix, Bayer, U.K.). Wound healing studies were undertaken 2 weeks after induction of diabetes and were performed as previously described (Wang et al., 2007). A single topical application of 50 μl of 10 μM unmodified Cx43asODNs GTAATTGCGGCAGGAGGAATTGTTTCTGTC or control Cx43sODNs GACAGAAACAATTCCTCCTGCCGCAATTAC (Sigma) was delivered to wounds and tissue harvested at 24 h after wounding (for details on antisense, see Qiu et al., 2003). Blood glucose readings were taken and all rats were confirmed to be severely hyperglycaemic (blood glucose 27.1±1.1 mmol/l). 2.3. Cell culture Confluent monolayers of NIH 3T3 fibroblasts were grown in 5.5% glucose DMEM (D5796: Invitrogen) supplemented 10% fetal bovine serum and penicillin/streptomycin. In some experiments, the level of glucose was elevated to 25 or 40 mM or an osmotic control of 19.5 or 34.5 mM mannitol. Cells were cultured in these conditions for 2 weeks prior to the experiments being performed. Dye injection was carried out according to the method described in Becker et al. (1995). The scratch wound assay was performed on confluent monolayers of fibroblasts as described in Mori et al. (2006) and migration was monitored by time lapse imaging over a 4 h period on an Olympus IX81 microscope. 2.4. Immunohistochemistry and imaging Immunostaining was carried out on cultured cells or cryostat sections of wounded and intact skin as described in Wang et al. (2007). Primary antibodies for Cx43 diluted 1:2000; Sigma, N-cadherin, diluted 1:100 (Abcam, ab18203) and ZO-1 (zonular occludin-1) diluted 1:100 (Zymed Laboratories, 61–7300) were incubated for 1 h at room temperature. Tissues were washed with PBS and then incubated with the secondary antibody swine anti-rabbit FITC-conjugated (DAKO). Secondary antibody incubation in the absence of primary antibody was used as negative control. Tissues were then counterstained for 10 min with 5 μg/ml of the nuclear dye Hoechst 33342 (Sigma) and images were acquired on a Leica SP2 confocal microscope (Leica Microsystems). All parameters during image acquisition were kept constant throughout each experiment to allow direct comparison of all of the 8 bit digital images. When imaging, major dermal appendages were avoided in the field of view as they express considerably more Cx43 and would have distorted the results. Immunostaining levels were quantified per unit area using a well-established pixel-counting method using ImageJ software (National Institutes of Health). Images were converted to binary images using an identical threshold. Objects greater than 2 pixels were counted in order to generate a readout of the number of positive pixels per unit area for comparison between conditions. Retroviral constructs: A retroviral p.Sup (pSuppressor) vector contained the Cx43shRNA sequence GGTGTGGCTGTCAGTGCT (van Zeijl et al., 2007), kindly donated by W.H. Moolenaar. A p.Sup retroviral vector acted as control and transfection was performed as described by Carr and Whitmore (2005). 2.5. Statistical analysis Statistical differences were determined using ANOVA followed by Tukey's analysis with P<0.05 taken as significant. 3. Results 3.1. Cx43, N-cadherin and ZO-1 protein levels in human biopsies The effect of the underlying diabetic state on the human fibroblast Cx43 protein levels from intact non-wounded dermis was negligible in terms of Cx43 protein levels (Figures 1A and 1B) in contrast with the effects of the DFU. Fibroblasts from within DFU showed a striking up-regulation of Cx43, which was ∼10-fold higher than the comparable intact diabetic or non-diabetic skin (Figures 1A and 1B; P<0.05). Cx43 is often closely associated with the tight junction protein ZO-1 and the adhesion protein N-cadherin and both of these proteins were also found to be elevated in the DFU samples. N-cadherin increased 6-fold in DFU compared with intact skin (Figures 1C and 1D; P<0.05) and mean ZO-1 was found to be elevated 2-fold, although this elevation did not reach significance (Figures 1E and 1F). We also noted that in the intact human skin, autofluorescent bundles of elastin could be seen (they are not seen in the rat skin) and these were absent from the wound edge of the DFU where they have been degraded by proteases. 3.2. Cx43 protein levels in wound edge fibroblasts of STZ rats Cx43 immunostaining of dermal fibroblasts in the wound-edge region of STZ diabetic rats (Figures 2A–2C) was more than double in control rats (Figures 2C and 2D; P<0.001) 24 h after wounding. This abnormal increase of Cx43 protein in diabetic wound-edge fibroblasts was efficiently prevented (P<0.001) by a single topical application of a Cx43-specific antisense gel (Cx43asODNs) immediately after wounding (Figures 2C and 2D). In the intact diabetic rat skin, there was found to be a significant increase in Cx43 in direct relation to blood glucose levels r = 0.625 (Figures 2E and 2F; P<0.01). 3.3. Fibroblast Cx43 expression and communication We cultured NIH 3T3 fibroblasts transduced with p.Sup or Cx43shRNA constructs under increasing glucose (5.5, 25 and 40 mM) conditions for 2 weeks, which has been previously used to mimic the diabetic state in these cells (Lin et al., 2008). To control for effects of increased glucose osmolarity, fibroblasts were also incubated in 5.5 mM glucose DMEM supplemented with 19.5 or 34.5 mM mannitol. The 40 mM levels of glucose resulted in significantly elevated levels of Cx43 protein as shown by Western blotting and immunostaining (Figures 3A–3D; P<0.01). This elevation in Cx43 protein levels was largely prevented by transduction with Cx43shRNA (P<0.001). We analysed the extent of cell communication in fibroblasts cultured in different concentrations of glucose. A significant increase in the incidence of dye coupling was seen in the highest glucose concentration (40 mM) compared with lower glucose or control high mannitol conditions (Figure 3E; P<0.01). 3.4. Fibroblast migration Cells cultured in increasing glucose conditions for 2 weeks migrated significantly slower in response to a scratch wound when imaged over a 4 h period (P<0.05 and P<0.001 for 25 and 40 mM glucose respectively) than 5.5 mM glucose (Figures 4A–4C). There were no significant changes in the rate of migration for fibroblasts incubated with 19.5 and 34.5 mM mannitol, ruling out osmotic effects (Figure 4A). When fibroblasts stably transduced with Cx43shRNA or p.Sup were incubated under increasing glucose and mannitol conditions, the Cx43shRNA largely prevented the Cx43 up-regulation seen in the 40 mM glucose conditions (Figure 3) and significantly enhanced the migration rates for all conditions (P<0.05 and P<0.001). Although the velocity of migration for the Cx43shRNA 40 mM high-glucose dose increased 2-fold over p.Sup 40 mM glucose, it did not reach the velocity seen in all of the other Cx43shRNA treatment conditions. However, it did match or exceed the rates obtained in all p.Sup-transfected fibroblasts cultures (Figure 4A). In addition, Cx43shRNA also enhanced the rate of production and the size of lamellipodial extensions at the leading edge of the migrating cells (Figures 4B and 4C), consistent with a more rapid onset of migration and greater motility. 4. Discussion We report a novel finding of a striking 10-fold increase in the expression level of the gap junction protein Cx43 quantified in dermal fibroblasts from biopsies of human DFU wound edges. We believe that this abnormal expression of Cx43, a protein that normally must be transiently down-regulated in acute wound healing, inhibits the ability of the fibroblasts to migrate and heal such chronic wounds. The effect of diabetes on connexin protein levels has been variably reported to increase, decrease or remain the same depending on the cell type and connexin type. We found Cx43 protein levels increased in direct relation to high blood glucose levels in STZ diabetic rat skin. This is consistent with both our in vitro studies and a report of elevated coupling in human isolated diabetic fibroblasts (Abdullah et al., 1999). The Cx43 in the unwounded diabetic human skin fibroblasts was not grossly altered compared with controls, which likely reflects the more restricted abnormal blood glucose range that is present in treated diabetic humans compared with experimental rats. Cultured human diabetic wound fibroblasts are reported to show a significant retardation of cell proliferation (Loots et al., 1999). However, cultured human diabetic fibroblasts have also been reported to have the same Cx43 levels as non-diabetic fibroblasts (Pollok et al., 2011). In the latter study, it was found that the application of a small mimetic peptide, GAP27 (GTPase-activating protein 27), which blocks Cx43 mediated communication, increased the migration rate of normal fibroblasts but not diabetic fibroblasts, although it was not apparent why this was the case (Pollok et al., 2011). Culture of juvenile human fibroblasts in 25 mM glucose for 5 days has recently been reported to decrease the coupling in terms of number of cells (whereas we found no change in the incidence of coupling with this concentration of glucose) and retard fibroblast migration, which can be rescued to some extent in the first 24 h, but not later, by the application of GAP27 peptide (Wright et al., 2012). Additionally, decreased Cx43 has been reported in the retinal vasculature of diabetic mice and in sympathetic neurons of the diabetic bladder, where Cx32 and Cx26 are increased (Poladia et al., 2005; Bobbie et al., 2010). Elevated glucose concentration in culture was reported to increase Cx43 protein expression in HCD (human collecting duct) kidney cells (Hills et al., 2006), which is similar to our findings. The 10-fold elevation in Cx43 protein levels we observed in DFU fibroblasts is unlikely to be solely explained by high glucose, since the patients were on diabetic treatments that provide some measure of attenuation to their underlying abnormal glucose levels. Thus, other factors in addition to a moderately abnormal chronic glucose exposure in these patients may also be driving Cx43 overexpression at the wound edge. The vasculature perfusion around the DFU is likely to be poor, resulting in low oxygen and nutrient levels (Coutinho et al., 2003; Mustoe, 2004; Dinh and Veves, 2005), which may promote the expression of Cx43 to increase levels of nutrients via the gap junctions. A range of growth factors in and around the DFU can also reportedly promote Cx43 expression, for example FGF2 (fibroblast growth factor 2) and FGF8 (Abdullah et al., 1999). We have previously shown that elevated levels of Cx43 protein appear in wound-edge keratinocytes of STZ diabetic rats and that this retards their migration (Wang et al., 2007). Here, we now show that elevation of Cx43 also occurs in wound-edge fibroblasts in STZ rats and this can be prevented by Cx43asODN (Figure 2). The increase in Cx43 in the intact STZ rat dermis was found to be in direct proportion to the level of blood glucose, so glucose itself can be at least in part a driver of Cx43 expression changes in fibroblasts. Similarly, we have shown that raising the level of glucose to 40 mM in the media of NIH 3T3 cell cultures elevated Cx43 protein levels and GJIC. This effect was brought about by the glucose itself and not the increased osmolarity, as similar levels of mannitol did not significantly increase Cx43 protein or GJIC. The elevated levels of Cx43 had a negative effect on the migration rate of fibroblasts, which is consistent with the perturbed wound healing of STZ diabetic rats that show abnormally elevated Cx43 in wound edges. Strong supportive evidence that elevated levels of Cx43 retard fibroblast migration was additionally provided by demonstrating that cells migrated at control rates or faster after Cx43 knockdown. Even at very high glucose levels (40 mM) the Cx43shRNA migration was 2-fold faster than p.Sup (40 mM) and in excess of the level seen at a p.Sup control (5.5 mM) glucose concentration. Although the Cx43shRNA could easily prevent expression of normal levels of Cx43 protein it did not entirely prevent the elevated levels induced by 40 mM glucose. Interestingly, when Cx43shRNA (40 mM glucose) Cx43 levels are similar to those of p.Sup (5.5 mM glucose) the migration rates are also similar. The importance of down-regulation of Cx43 protein during the wound healing process is highlighted by fibroblast migration being impaired when Cx43 protein levels are elevated. It would appear that the more Cx43 that is present the slower the fibroblasts migrate. The 10-fold elevation of Cx43 protein in the fibroblasts of DFU may explain why they fail to migrate. Precisely how Cx43 inhibits fibroblast migration is not yet clear. However, the cytoplasmic tail of Cx43 can interact with a number of cytoskeletal and membrane proteins such as α- and β-catenin, N-cadherin and ZO-1 and can form a multi-protein junctional complex sometimes referred to as a ‘Proteome’ or ‘nexus’ (Wei et al., 2005; Shaw et al., 2007; Laird, 2010), which may affect migration. In addition, it has been hypothesized that the Cx43 gene may be a master gene that can control the expression of over 300 other genes (Spray and Iacobas, 2007). Our discovery that both ZO-1 and N-cadherin are up-regulated in the dermis of human diabetic skin, and even more in DFU, may fit with the concept of Cx43 as a control gene. The increase in adhesion generated by the elevated N-cadherin may contribute to the retarded migration of the fibroblasts. Additionally, cell–cell adhesion will also increase by virtue of the elevated Cx43–Cx43 hemichannel docking between DFU fibroblasts. 5. Summary and conclusions Ten-fold elevations of Cx43 have been shown in dermal fibroblasts of human biopsies from DFUs. Cx43 is elevated in the STZ diabetic rat dermis in proportion to the level of blood glucose. A 3-fold elevation of Cx43 in the wound-edge dermis of the STZ diabetic rat occurred, which could be corrected by the application of Cx43-specific antisense to the wound. In cultured fibroblasts, high levels of glucose can elevate Cx43 protein levels, which retard fibrobast migration in vitro. The results support the idea increased Cx43 expression may be a fundamental cause of poor fibroblast migration and reduced healing rates in diabetic ulcers. Author contribution Ariadna Mendoza-Naranjo performed the majority of experiments and analysis and contributed to the writing. Peter Cormie, Antonio Serrano, Chuihui Wang, Christopher Thrasivoulou, Jessica Sutcliffe and Daniel Gilmartin performed experiments analysis and figure production. Janice Tsui and Thomas Serena collected and contributed human biopsies. Anthony Phillips contributed to experimental design, statistical analysis and writing of the manuscript. David Becker contributed to experimental design, experimental work, statistical analysis and writing of the paper. Acknowledgement We are grateful to Dr W.H. Moolenaar for the gift of the Cx43shRNA. Funding This work was supported, in part, by REFERENCES Abdullah, KM, Luthra, G, Bilski, JJ, Abdullah, SA, Reynolds, LP and Redmer, DA (1999) Cell-to-cell communication and expression of gap junctional proteins in human diabetic and nondiabetic skin fibroblasts: effects of basic fibroblast growth factor. Endocrine 10, 35-41 Becker, DL, Evans, WH, Green, CR and Warner, A (1995) Functional analysis of amino acid sequences in connexin43 involved in intercellular communication through gap junctions. J Cell Sci 108, 1455-67 Bobbie, MW, Roy, S, Trudeau, K, Munger, SJ and Simon, AM (2010) Reduced connexin 43 expression and its effect on the development of vascular lesions in retinas of diabetic mice. Invest Ophthalmol Vis Sci 51, 3758-63 Brandner, JM, Houdek, P, Husing, B, Kaiser, C and Moll, I (2004) Connexins 26, 30, and 43: differences among spontaneous, chronic, and accelerated human wound healing. J Invest Dermatol 122, 1310-20 Carr, AJ and Whitmore, D (2005) Imaging of single light-responsive clock cells reveals fluctuating free-running periods. Nat Cell Biol 7, 319-21 Coutinho, P, Qiu, C, Frank, S, Tamber, K and Becker, D (2003) Dynamic changes in connexin expression correlate with key events in the wound healing process. Cell Biol Int 27, 525-41 Dinh, TL and Veves, A (2005) A review of the mechanisms implicated in the pathogenesis of the diabetic foot. Int J Lower Extrem Wounds 4, 154-9 Goliger, JA and Paul, DL (1995) Wounding alters epidermal connexin expression and gap junction-mediated intercellular communication. Mol Biol Cell 6, 1491-501 Hills, CE, Bland, R, Wheelans, DC, Bennett, J, Ronco, PM and Squires, PE (2006) Glucose-evoked alterations in connexin43-mediated cell-to-cell communication in human collecting duct: a possible role in diabetic nephropathy. Am J Physiol Renal Physiol 291, F1045-51 Kandyba, EE, Hodgins, MB and Martin, PE (2008) A murine living skin equivalent amenable to live-cell imaging: analysis of the roles of connexins in the epidermis. J Invest Dermatol 128, 1039-49 Kretz, M, Euwens, C, Hombach, S, Eckardt, D, Teubner, B and Traub, O (2003) Altered connexin expression and wound healing in the epidermis of connexin-deficient mice. J Cell Sci 116, 3443-52 Laird, DW (2010) The gap junction proteome and its relationship to disease. Trends Cell Biol 20, 92-101 Lin, HI, Chu, SJ, Perng, WC, Wu, CP, Lin, ZY and Huang, KL (2008) Hyperbaric oxygen attenuates cell growth in skin fibroblasts cultured in a high-glucose medium. Wound Repair Regen 16, 513-9 Loots, MA, Lamme, EN, Mekkes, JR, Bos, JD and Middelkoop, E (1999) Cultured fibroblasts from chronic diabetic wounds on the lower extremity (non-insulin-dependent diabetes mellitus) show disturbed proliferation. Arch Dermatol Res 291, 93-9 Mori, R, Power, KT, Wang, CM, Martin, P and Becker, DL (2006) Acute downregulation of connexin43 at wound sites leads to a reduced inflammatory response, enhanced keratinocyte proliferation and wound fibroblast migration. J Cell Sci 119, 5193-203 Mustoe, T (2004) Understanding chronic wounds: a unifying hypothesis on their pathogenesis and implications for therapy. Am J Surg 187, 65S-70S Poladia, DP, Schanbacher, B, Wallace, LJ and Bauer, JA (2005) Innervation and connexin isoform expression during diabetes-related bladder dysfunction: early structural vs. neuronal remodelling. Acta Diabetol 42, 147-52 Pollok, S, Pfeiffer, AC, Lobmann, R, Wright, CS, Moll, I and Martin, PE (2011) Connexin 43 mimetic peptide Gap27 reveals potential differences in the role of Cx43 in wound repair between diabetic and non-diabetic cells. J Cell Mol Med 15, 861-73 Qiu, C, Coutinho, P, Frank, S, Franke, S, Law, LY and Martin, P (2003) Targeting connexin43 expression accelerates the rate of wound repair. Curr Biol 13, 1697-703 Shaw, RM, Fay, AJ, Puthenveedu, MA, von Zastrow, M, Jan, YN and Jan, LY (2007) Microtubule plus-end-tracking proteins target gap junctions directly from the cell interior to adherens junctions. Cell 128, 547-60 Spray, DC and Iacobas, DA (2007) Organizational principles of the connexin-related brain transcriptome. J Membr Biol 218, 39-47 van Zeijl, L, Ponsioen, B, Giepmans, BN, Ariaens, A, Postma, FR and Varnai, P (2007) Regulation of connexin43 gap junctional communication by phosphatidylinositol 4,5-bisphosphate. J Cell Biol 177, 881-91 Wall, IB, Moseley, R, Baird, DM, Kipling, D, Giles, P and Laffafian, I (2008) Fibroblast dysfunction is a key factor in the non-healing of chronic venous leg ulcers. J Invest Dermatol 128, 2526-40 Wang, CM, Lincoln, J, Cook, JE and Becker, DL (2007) Abnormal connexin expression underlies delayed wound healing in diabetic skin. Diabetes 56, 2809-17 Wei, CJ, Francis, R, Xu, X and Lo, CW (2005) Connexin43 associated with an N-cadherin-containing multiprotein complex is required for gap junction formation in NIH 3T3 cells. J Biol Chem 280, 19925-36 Wright, CS, Pollok, S, Flint, DJ, Brandner, JM and Martin, PE (2012) The connexin mimetic peptide Gap27 increases human dermal fibroblast migration in hyperglycemic and hyperinsulinemic conditions in vitro. J Cell Physiol 227, 77-87 Wright, CS, van Steensel, MA, Hodgins, MB and Martin, PE (2009) Connexin mimetic peptides improve cell migration rates of human epidermal keratinocytes and dermal fibroblasts in vitro. Wound Repair Regen 17, 240-9 Received 15 November 2011/2 March 2012; accepted 28 March 2012 Published as Cell Biology International Immediate Publication 28 March 2012, doi:10.1042/CBI20110628 © The Author(s) Journal compilation © 2012 International Federation for Cell Biology |
ISSN Print: 1065-6995
ISSN Electronic: 1095-8355 Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB) |