Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2012) 36, 843–849 (Printed in Great Britain)
Targeted suppression of μ-calpain and caspase 9 expression and its effect on caspase 3 and caspase 7 in satellite cells of Korean Hanwoo cattle
You Bing Yang, Muthuraman Pandurangan and InHo Hwang1
Department of Animal Science and Institute of Rare Earth for Biological Applications, Chonbuk National University, Jeonju, 561756, Korea


The calpains play an important role in cell death and cell signalling. Caspases catalyse wholesale destruction of cellular proteins which is a major cause of cellular death. The current study looks at the function of μ-calpain and caspase 9, using RNAi (RNA interference)-mediated silencing, and to observe the mRNA expression level of caspase genes during satellite cell growth. The satellite cells were treated with siRNA (small interfering RNA) of μ-calpain and caspase 9 separately. There was reduction of 16 and 24% in CAPN1 (calpain1)-siRNA2 and CAPN1-siRNA3 transfected cells respectively, whereas it was 60 and 56% in CAPN1-siRNA1 and CAPN1-siRNA4 transfected cells respectively. CAPN1-siRNA4 and CAPN1-siRNA1 treated cells showed more reduction in caspase 3 and 7 gene expression. CARD9 (caspase recruitment domain 9)-siRNA1 and CARD9-siRNA2-treated cells showed reduction of 40 and 49% respectively. CARD9-siRNA1 and CARD9-siRNA2 showed an increase in caspase 3 gene expression, whereas CARD9-siRNA2 showed reduction in caspase 7 gene expression. These results suggest a strong cross-talk between μ-calpain and the caspase enzyme systems. Suppression of target genes, such as μ-calpain and caspase 9, might have genuine potential in the treatment of skeletal muscle atrophy.


Key words: caspases, Hanwoo cattle, μ-calpain, RNA interference, RT–PCR, satellite cell

Abbreviations: AIF, apoptosis-inducing factor, APAF1, apoptotic protease-activating factor 1, CAPN1, calpain1, CARD, caspase recruitment domain, GAPDH, glyceraldehyde-3-phosphate dehydrogenase, GM, growth medium, RNAi, RNA interference, RT–PCR, reverse transcription–PCR, siRNA, small interfering RNA

1To whom correspondence should be addressed (email ram_bio2000@yahoo.co.in).


1. Introduction

Muscle tissue possesses the post-natal growth and intrinsic regenerative capacity (Bischoff, 1986). Comprehensive understanding of the satellite cell's involvement in postnatal myogenesis, skeletal muscle hypertrophy and myofibre regeneration are noteworthy issue for fundamental agricultural reasons. Calpains are intracellular non-lysosomal Ca2+-regulated cysteine proteases and they mediate regulatory cleavages of specific substrates in various cellular processes such as signal transduction, cell proliferation and differentiation, apoptosis and necrosis in mammals (Goll et al., 2003; Suzuki et al., 2004; Bartoli and Richard, 2005). Muscle tissue expresses mainly 3 distinct calpains: the ubiquitous calpains 1 and 2 (also called μ- and m) which are the best-characterized calpains and calpain 3 (also called p94), which is highly expressed in this tissue. However, since conventional inhibitors used for the studies of the functions of these enzymes lack specificity, the individual physiological function and biochemical mechanism of these 3 isoforms, especially μ-calpain, are unclear (Wu et al., 2006). In contrast, RNAi (RNA interference) has a great potential to distinguish the functions of each member in a closely related gene family or to selectively target a mutant gene, especially to study the functions of a particular isoform. Several studies have revealed that the potential role of calpains involving apoptosis is indicated by a increasing list of calpains substrates such as p53, PARP [poly(ADP-ribose) polymerase], Bax, AIF (apoptosis-inducing factor) and several cytoskeletal proteins (Goll et al., 2003; Suzuki et al., 2004; Polster et al., 2005; Artus et al., 2006; Cao et al., 2007; Norberg et al., 2008). Although calpains are known to contribute to apoptosis, further studies are needed to elucidate precisely the role of calpains in apoptosis.

Cross-talk between the calpain and the caspase systems has been reported (Vaisid et al., 2005; Artus et al., 2006; Del Bello et al., 2007; Liu et al., 2009). Caspases are another family of proteases involved in programmed cell death; the caspases appear to play a role in these processes, such as initiator caspases (caspases 2, 8 and 9) and effector caspases (caspases 3, 6, 7 and 14) (Sordet et al., 1999; Fernand et al., 2002). The role of these caspases in muscle cell development or differentiation process in Hanwoo cattle is very limited. Earlier studies from our group indicated elevation of caspase 9 expression during satellite cell proliferation and differentiation. In continuance with these investigations, the present work was designed to study the key role of μ-calpain and caspases using RNAi-mediated silencing of μ-calpain and caspase 9 during satellite cell proliferation. To determine the molecular involvement of μ-calpain and caspase 9, this study focuses on (i) the cross-talk between μ-calpain and caspases such as effector caspases, caspase 3 and caspase 7; and (ii) how caspases are involved in the process of muscle satellite-cell proliferation. Our results indicate that numerous apoptotic pathways might take place during muscle cell myogenesis. Therefore μ-calpain might play a major role in the regulation of muscle cell myogenesis, including intervening in the activity of other proteolytic systems as well as the caspase systems. μ-calpain may thus play a role in muscle cell death, and consequently in muscle atrophy.

2. Materials and methods

2.1. Drugs used and laboratory wares

All chemicals and laboratory wares were purchased from Sigma–Aldrich Chemical Co. and Falcon Labware (Becton-Dickinson) respectively.

2.2. Cell preparation and culture

Satellite cells were isolated from 30-month-old Korean Hanwoo cattle according to the method of Dodson et al. (1987), with suitable modification. Briefly, longissimus dorsi muscle was excised from Korean Hanwoo cattle within a few minutes following slaughter. All the procedures dealing with treatment and killing of the animals were carried out according to international ethical committee regulations. The epimysium and most of the fat was trimmed off and discarded. Muscle strips were ground in a small, sterile meat grinder. After enzymatic digestion with pronase (1 mg/ml) at 37°C for 60 min, single cells were separated from the tissue fragments by repeated centrifugation. The primary muscle cells were cultured in GM [growth medium; DMEM (Dulbecco's modified Eagle's medium; Gibco] containing 15% FBS (fetal bovine serum; Gibco), 100 I.U. (international units)/ml penicillin, and 100 μg/ml streptomycin) in a humidified air incubator at 37°C with 5% CO2. When the cells reached 80% confluence, they were collected and resuspended in PBS supplemented with 0.5% BSA and 2 mM EDTA. Following centrifugation, the pellet was resuspended in 100 μl of PBS containing 10 μg anti-M-cadherin antibody and incubated with 20 μl anti-mouse IgG1 microbeads at 4°C for 1 h. Finally, cell suspensions (107 cells in 500 μl of PBS) were loaded on to a magnetic cell-sorting system, AutoMACS (Milteny Biotec), to isolate the satellite cells, which were cultured in GM at 37°C in a humidified environment of 95% air and 5% CO2. Satellite cells cultivated in GM were subcultured when they became ∼80% confluent and cells of 4 passages were used for the present experiments.

2.3. siRNA (small interfering RNA)-mediated μ-calpain gene and caspase 9 silencing

siRNAs were transcribed with T7 RNA polymerase using Silencer® siRNA Construction Kit (Ambion). Four siRNAs of μ-calpain and two siRNAs of capase 9 (Table 1) were designed using the siRNA target finder program from the Ambion Inc. (www.ambion.com/techlib/misc/siRNA_finder.html) and compared with the appropriate bovine genome database using BLAST to eliminate any target sequences with >16 contiguous base pairs of homology with other coding sequences. The siRNAs specific to the catalytic subunits of μ-calpain and caspase 9 formed complexes with polyamine-based transfectant, siPORT Amine (Ambion). The siRNA–amine complexes were transfected in the cultured cells at a final concentration of 30 nM in a 6-well plate at 80% cell confluence.


Table 1 Sequences of siRNAs used to knockdown bovine μ-calpain and caspase 9

Gene Oligonucleotide name Antisense siRNA oligonucleotide template Sense siRNA oligonucleotide template
CAPN1 (μ-calpain) CAPN1-siRNA1 AACCTATGGCATCAAGTGGAACCTGTCTC AATTCCACTTGATGCCATAGGCCTGTCTC
CAPN1-siRNA2 AACTGGAACACCACCCTGTATCCTGTCTC AAATACAGGGTGGTGTTCCAGCCTGTCTC
CAPN1-siRNA3 AACTTCAAGTCCCTCTTCAGACCTGTCTC AATCTGAAGAGGGACTTGAAGCCTGTCTC
CAPN1-siRNA4 AACAAGGAAGGTGACTTTGTGCCTGTCTC AACACAAAGTCACCTTCCTTGCCTGTCTC
CARD9 (caspase 9) CARD9-siRNA1 AATGAGCGAGGTGATGAAGCTCCTGTCTC AAAGCTTCATCACCTCGCTCACCTGTCTC
CARD9-siRNA2 AAGGAGAGCTTCGAGAACTACCCTGTCTC AAGTAGTTCTCGAAGCTCTCCCCTGTCTC



2.4. RNA isolation and real-time RT–PCR (reverse transcription–PCR)

Following siRNA transfection for 48 h, cells were lysed in TRIzol® reagent and total RNA was extracted from both transfected and untransfected samples. The first-strand cDNA was synthesized from 1 μg of total RNA using the MMLV (Moloney-murine-leukaemia virus) reverse transcriptase with the anchored oligo(dT)12–18 primer (Gene Link). Real-time PCR was performed using a cDNA equivalent of 10 ng of total RNA from each sample with primers specific for bovine μ-calpain, caspase 3, caspase 7, caspase 9 and a housekeeping gene encoding GAPDH (glyceraldehyde-3-phosphate dehydrogenase) (Table 2). The reaction was carried out in 10 μl using SsoFastTM EvaGreen® Supermix (Bio-Rad) according to the manufacturers' instructions. Relative ratios were calculated based on the 2−ΔΔCt method (Pfaffl, 2001). PCR was monitored using the CFX96™ Real-Time PCR Detection Systems (Bio-Rad).


Table 2 Real-time PCR primers and conditions used in this study

Gene Primer sequences (5′3′) Amplicon length (bp) Annealing temperature(°C) GenBank® accession no.
CAPN1 (μ-calpain) Forward: CCCTCAATGACACCCTCC 109 57 AF221129.1
Reverse: TCCACCCACTCACCAAACT
CASP3 (caspase 3) Forward: GTTCATCCAGGCTCTTTG 97 56 NM_001077840.1
Reverse: TTCTATTGCTACCTTTCG
CASP7 (caspase 7) Forward: GAATGGGTGTCCGCAACG 106 51 XM_604643.4
Reverse:TTGGCACAAGAGCAGTCGTT
CARD9 (caspase 9) Forward: CGCCACCATCTTCTCCCTG 84 60 BC116138.1
Reverse: CCAACGTCTCCTTCTCCTCC
GAPDH Forward: CACCCTCAAGATTGTCAGC 98 57 NM_001034034
Reverse: TAAGTCCCTCCACGATGC



2.5. Statistical analysis

All the values are expressed as means±S.E.M. Statistical analysis was performed using SPSS version 16.0 (Statistical Package). Student's t test was performed to determine the differences between control and treatments. P≤0.05 was considered as significant.

3. Results

The 4 separate siRNA sequences were screened for their ability to inhibit μ-calpain gene expression. Following optimizing the transfection conditions for cell number, volume of transfection agent used and the appropriate concentration of each siRNA, quantitative real-time PCR were used to assess the inhibition of gene expression achieved by all siRNA sequences used. The gene expression of CAPN1 (calpain1)-siRNA2 and CAPN1-siRNA3 was reduced by 16 and 24% respectively, when compared with untransfected satellite cells. The expression of CAPN1-siRNA1 and CAPN1-siRNA4 was significantly reduced by 60 and 56% respectively. The optimal knockdown was achieved when cells were incubated for 48 h after transfection (Figure 1).

Caspase 3 and caspase 7 mRNA expression were quantified in CAPN1-siRNA-treated cells by real-time PCR analysis. CAPN1-siRNA4-treated cells showed more reduction caspase 3 gene expression when compared with untransfected cells (Figure 2). Similarly, satellite cells transfected with CAPN1-siRNA1 and CAPN1-siRNA4 also showed a significant reduction in caspase 7 gene expression (Figure 3).

Two separate siRNA sequences were screened for their ability to inhibit caspase 9 gene expression. Following optimizing the transfection conditions for cell number, the volume of transfection agent used and the appropriate concentration of each siRNA, quantitative real-time PCR was used to assess the inhibition of gene expression achieved by each of the siRNA sequences. The gene expression of CARD9 (caspase recruitment domain 9)-siRNA1 and CARD9-siRNA2 was reduced by 40 and 49% respectively, when compared with the untransfected satellite cells. The optimal knockdown was achieved when cells were incubated for 48 h after transfection (Figure 4).

Caspase 3 and caspase 7 mRNA expression were quantified in CARD9-siRNA treated cells by real-time PCR analysis. CARD9-siRNA2 transfected cells showed the significant reduction of caspase 7 gene expression compared with untransfected cells (Figure 5). However, satellite cell transfected with CARD9-siRNA1 and CARD9-siRNA2 showed increased caspase 3 gene expression (Figure 6).

4. Discussion

The in vitro properties exhibited by primary cultures of satellite cell more closely reflect their in vivo properties than those exhibited by transformed cell lines (Allen, 1987). Furthermore, primary cell cultures, transformed cell lines cultures and isolated myofibre cultures have all been used to undertake general aspects of satellite cell physiology and satellite cell regulation (Allen et al., 1985; Dodson and Allen, 1987; Dodson et al., 1987).

However, the use of in vitro systems remains hotly debated; both critics and proponents have tended to agree that the use of in vitro systems for determining the developmental biology of satellite cells has resulted in considerable, and useful, data (Rhoads et al., 2009). Numerous papers have been published involving the animal as a major experimental unit that were to develop species-specific satellite cell cultures (Greenlee et al., 1995; Dodson et al., 1996; Burton et al., 2000). However, all these satellite cell researchers are concerned about some contaminating cells, such as fibroblasts, which were co-isolated with satellite cells during cell isolation regimens because these contaminating cells potentially could overrun cultures and provide biased measures of cell activity in vitro (Rhoads et al., 2009). In our study, to decrease the presence of non-myogenic cells in primary cultures, the cell suspensions were loaded on to a magnetic cell-sorting system, AutoMACS (Milteny Biotec) to isolate the satellite cells, which improved the certainty that culture systems were controlled and interpretable.

RNAi has a great potential to distinguish distinct functions of each member in a closely related gene family. Therefore we used siRNA-mediated knockdown of μ-calpain expression in bovine satellite cells that led to decreased caspase 3 and caspase 7 expression, suggesting that there was a cross-talk between μ-calpain and the caspase systems. Such cross-talk between two protease systems has also been shown by Vaisid et al. (2005) in the differentiation of PC12 cells. Piñeir et al. (2007) reported that taxol induces apoptosis in NIH 3T3 cells by a caspase 3-independent mechanism in which calpain could be playing some role. Our study revealed that calpain mediated the caspase cascade (Figures 2 and 3) and is consistent with previous report by Liu et al. (2009); the previous report found that suppression of μ-calpain reduced the activities of caspase 9 and caspase 3. The precise mechanism of the cross-talk between μ-calpain and the caspase proteolytic systems is not clearly established. One paper hypothesised that calpain activation may be upstream or down-stream of caspases (Rami, 2003). We found that targeted suppression of μ-calpain by siRNA could greatly reduce caspase 3 and 7 mRNA expression and these results implied that calpain activation was the upstream of caspases in our experimental model. Liu et al. (2009) reported that μ-calpain activation was upstream of caspase and such activation played an important role in regulating both caspase-dependent and AIF-mediated caspase-independent apoptotic pathways. This previous study also agrees with that hypothesis. However, the precise mechanism of these regulating factors involving the apoptotic pathway is not well understood and still need to be precisely elucidated.

The results indicate that caspase 9 and caspase 7 play some role in the proliferation of satellite cells, a conclusion based on the effects of targeted suppression of caspase 9 expressions (Figure 5). Over the years, there have been numerous reports that indicate the existence of caspase-independent pathways leading to cell death (McNeish et al., 2003; Bello et al., 2004; Scoltock and Cidlowski, 2004; Chipuk and Green, 2005; Kroemer and Martin, 2005; Schamberger et al., 2005; Piñeiro et al., 2007; Eguchi et al., 2009). Caspases are generally divided into 2 classes according to their primary structure: the initiator caspases, caspases 2, 8 and 9, which contain long N-terminal pro-domains; and the effector caspases, caspases 3, 6 and 7, which contain short pro-domains (Cohen, 1997; Nicholson, 1999; Shi, 2002). In our previous study we have found caspase 9 mRNA expression increased significantly during cattle muscle satellite cell proliferation and differentiation and few researchers have investigated the role of caspases during muscle cell growth.

We need to clarify whether and how caspases are involved in the process of muscle satellite cell proliferation. To date, as we know there are at least 2 major cross-talking pathways in cells involving apoptosis: (a) the mitochondrion-initiated pathway (intrinsic pathway) and (b) the cell surface death receptors pathway (extrinsic pathway) (Ashkenazi and Dixit, 1998; Green and Reed, 1998; Slee et al., 2000; Strasser et al., 2000). Previous studies have shown that treatment of ovarian carcinoma cells with caspase 9 inhibitor reduced both caspase 9 and caspase 3 activation (McNeish et al., 2003). This evidence and our results both support the idea of caspase-depended pathway (Kischkel et al., 1995; Medema et al., 1997; Shi, 2001). Apoptotic signalling and the mitochondrion-initiated pathway leading to cell death involve the activation of caspases which in turn cleave key protein substrates. The first involves the release of cytochrome c from mitochondria, which then binds to APAF1 (apoptotic protease-activating factor 1) in the apoptosome, leading to the activation of caspase 9, which activates the downstream effector caspases such as caspases 3, 6 and 7. In this study, knockdown of caspase 9 expression led to a decrease in caspase 7 expression in satellite cells, which is slightly differed from results of McNeish et al. (2003). McNeish et al. (2003) reported that inhibition of caspase 9 activation subsequently reduced caspase 3 activation and it is possible that differences in caspase levels between different cell culture systems could be responsible of different effector caspase executions.

Herein, caspase 9 acts as an initiator caspase and caspase 7 acts as an effector caspase which are possibly involved in satellite cell proliferation. However, our knockdown of caspase 9 expression in satellite cells led to an increase in caspase 3 expression (Figure 6), probably satellite cells were stressed from exposure to a high concentration (30 nM) of transfection agent–siRNA complex and different pathways of apoptosis occurred. There is still a possibility that other initiator/effector caspases and proteinases carried out the role of caspase 3 in proliferation muscle satellite cell. Taken together, we hypothesize that apoptosis take place via a mitochondrial pathways during cattle muscle satellite cell proliferation. Apoptosis is a genetically programmed form of cell death that can be triggered through death receptors such as the TNF (tumour necrosis factor) receptor or via mitochondrial pathways (Rossi and Gaidano, 2003). The intrinsic death signalling pathway is induced by the release of cytochrome c from mitochondria. Cytochrome c, APAF1 and caspase 9 then form a complex called the apoptosome that results in the activation of caspase 7 as the down-stream effector caspase (Hengartner, 2000).

Apoptosis is a phenomenon that can participate in atrophy by leading to loss of myofibres (hypoplasia) or loss of myofibre segments (hypotrophy) (Bartoli and Richard, 2005). The only relationship between calpains and apoptosis in atrophy known to date is that induction of apoptosis by dexamethasone is dependent on calpain activation (Squier et al., 1994) and that some apoptosis-related proteins such as p53, cain/cabin1 and caspase 3 are substrates of calpains (Kim et al., 2002; Bizat et al., 2003). Wang et al. (2002) reported that suppression of the caspase 9 activations might have a potential to reduce the number of neuronal cells undergoing apoptotic cell death. Based on the above results, we suggest that targeted suppression of μ-calpain and caspase 9 may lead to the reduction in apoptotic cells.

5. Conclusion

Our findings indicate that knockdown of μ-calpain lead to the reduction in caspase 3 and caspase 7 gene expression, suggesting that there were a cross-talk between μ-calpain and the caspase enzyme systems. In addition, targeted suppression of caspase 9 gene expression reduced caspase 7 activation and we hypothesized that apoptosis takes place through an intrinsic pathway during satellite cell proliferation. More to the point, μ-calpain could have a multi-faceted function in the regulation of gene expression during muscle cell growth. We also suggest that suppression of target genes such as μ-calpain and caspase 9 might have genuine potential in the treatment of skeletal muscle atrophy.

Author contribution

You Bing Yang and Muthuraman Pandurangan performed the experiments and wrote the paper. InHo Hwang guided the project.

Funding

This work was partly supported by the Next-Generation BioGreen 21 Program [grant number PJ008191] and a research fund for FTA issues from the Rural Development Administration, Republic of Korea [grant number PJ907055].

REFERENCES

Allen, RE (1987) Muscle cell culture as a tool in animal growth research. Fed Proc 46, 290-4
Medline   1st Citation  

Allen, RE, Dodson, MV, Luiten, LS and Boxhorn, LK (1985) A serum-free medium that supports the growth of cultured skeletal muscle satellite cells. In Vitro Cell Dev Biol 21, 636-40
Crossref   Medline   1st Citation  

Artus, C, Maquarre, E, Moubarak, RS, Delettre, C, Jasmin, C and Susin, SA (2006) CD44 ligation induces caspase-independent cell death via a novel calpain/AIF pathway in human erythroleukemia cells. Oncogene 25, 5741-51
Crossref   Medline   1st Citation   2nd  

Ashkenazi, A and Dixit, VM (1998) Death receptors: signaling and modulation. Science 281, 1305-8
Crossref   Medline   1st Citation  

Bartoli, M and Richard, I (2005) Calpains in muscle wasting. Int J Biochem Cell Biol 37, 2115-33
Crossref   Medline   1st Citation   2nd  

Bello, BD, Valentini, MA, Mangiavacchi, P, Comporti, M and Maellaro, E (2004) Role of caspases-3 and -7 in Apaf 1 proteolytic cleavage and degradation events during cisplatin-induced apoptosis in melanoma cells. Exp Cell Res 293, 302-10
Crossref   Medline   1st Citation  

Bischoff, R (1986) Proliferation of muscle satellite cells on intact myofibers in culture. Dev Biol 115, 129-39
Crossref   Medline   1st Citation  

Bizat, N, Hermel J, M, Humbert, S, Jacquard, C, Creminon, C and Escartin, C (2003) In vivo calpain/caspase cross-talk during 3-nitropropionic acid-induced striatal degeneration: implication of a calpain-mediated cleavage of active caspase-3. J Biol Chem 278, 43245-53
Crossref   Medline   1st Citation  

Burton, NM, Vierck, J, Krabbenhoft, L, Bryne, K and Dodson, MV (2000) Methods for animal satellite cell culture under a variety of conditions. Methods Cell Sci 22, 51-61
Crossref   Medline   1st Citation  

Cao, G, Xing, J, Xiao, X, Liou, AK, Gao, Y and Yin, XM (2007) Critical role of calpain I in mitochondrial release of apoptosis-inducing factor in ischemic neuronal injury. J Neurosci 27, 9278-93
Crossref   Medline   1st Citation  

Chipuk, JE and Green, DR (2005) Do inducers of apoptosis trigger caspase-independent cell death? Nat Rev Mol Cell Biol 6, 268-75
Crossref   Medline   1st Citation  

Cohen, GM (1997) Caspases: the executioners of apoptosis. Biochem J 326, 1-16
Medline   1st Citation  

Del Bello, B, Moretti, D, Gamberucci, A and Maellaro, E (2007) Cross-talk between calpain and caspase-3/-7 in cisplatin-induced apoptosis of melanoma cells: a major role of calpain inhibition in cell death protection and p53 status. Oncogene 26, 2717-26
Crossref   Medline   1st Citation  

Dodson, MV and Allen, RE (1987) Interaction of multiplication stimulating activity/rat insulin-like growth factor II with skeletal muscle satellite cells during aging. Mech Ageing Dev 39, 121-8
Crossref   Medline   1st Citation  

Dodson, MV, Martin, EL, Brannon, MA, Mathison, BA and Mcfarland, DC (1987) Optimization of bovine satellite cell derived myotube formation in vitro. Tissue Cell 19, 159-66
Crossref   Medline   1st Citation   2nd  

Dodson, MV, McFarland, DC, Grant, AL, Doumit, ME and Velleman, SG (1996) Extrinsic regulation of domestic animal-derived satellite cells. Domes Anim Endocrinol 13, 107-26
Crossref   1st Citation  

Eguchi, R, Toné, S, Suzuki, A, Fujimori, Y, Nakano, T and Kaji, K (2009) Possible involvement of caspase-6 and -7 but not caspase-3 in the regulation of hypoxia-induced apoptosis in tube-forming endothelial cells. Exp Cell Res 315, 327-35
Crossref   Medline   1st Citation  

Fernand, P, Kelly, JF, Balazsi, K, Slack, RS and Megeney, LA (2002) Caspase 3 activity is required for skeletal muscle differentiation. Proc Natl Acad Sci USA 99, 11025-30
Crossref   Medline   1st Citation  

Hengartner, MO (2000) The biochemistry of apoptosis. Nature 407, 770-6
Crossref   Medline   1st Citation  

Goll, DE, Thompson, VF, Li, HQ, Wei, W and Cong, JY (2003) The calpain system. Phys Rev 83, 731-801
1st Citation   2nd  

Green, DR and Reed, JC (1998) Mitochondria and apoptosis. Science 281, 1309-12
Crossref   Medline   1st Citation  

Greenlee, AR, Dodson, MV, Yablonka-Reuveni, Z, Kersten, CA and Cloud, JG (1995) In vitro differentiation of myoblasts from skeletal muscle of rainbow trout Oncorhynchus mykiss. J Fish Biol 46, 731-47
1st Citation  

Kim, MJ, Jo, DG, Hong, GS, Kim, BJ, Lai, M and Cho, DH (2002) Calpain-dependent cleavage of cain/cabin1 activates calcineurin to mediate calcium-triggered cell death. Proc Natl Acad Sci USA 99, 9870-5
Crossref   Medline   1st Citation  

Kischkel, FC, Hellbardt, S, Behrmann, I, Germer, M, Pawlita, M and Krammer, PH (1995) Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. Eur Mol Biol Organ J 14, 5579-88
1st Citation  

Kroemer, G and Martin, SJ (2005) Caspase-independent cell death. Nature Med 11, 725-30
Crossref   Medline   1st Citation  

Liu, L, Xing, D and Chen, WR (2009) μ-Calpain regulates caspase-dependent and apoptosis inducing factor-mediated caspase-independent apoptotic pathways in cisplatin-induced apoptosis. Int J Cancer 125, 2757-66
Crossref   Medline   1st Citation   2nd   3rd  

McNeish, IA, Bell, S, McKay, T, Tenev, T, Marani, M and Lemoine N, R (2003) Expression of Smac/DIABLO in ovarian carcinoma cells induces apoptosis via a caspase-9-mediated pathway. Exp Cell Res 286, 186-98
Crossref   Medline   1st Citation   2nd   3rd   4th  

Medema, JP, Scaffidi, C, Kischkel, FC, Shevchenko, A and Peter, ME (1997) FLICE is activated by association with the CD95 death-inducing signaling complex (DISC). Eur Mol Biol Organ J 16, 2794-804
1st Citation  

Nicholson, DW (1999) Caspase structure, proteolytic substrates, and function during apoptotic cell death. Cell Death Differ 6, 1028-42
Crossref   Medline   1st Citation  

Norberg, E, Gogvadze, V, Ott, M, Horn, M, Uhlen, P and Orrenius, S (2008) An increase in intracellular Ca (21) is required for the activation of mitochondrial calpain to release AIF during cell death. Cell Death Diff 15, 1857-64
Crossref   1st Citation  

Pfaffl, MW (2001) A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res 29, e45
Crossref   Medline   1st Citation  

Piñeiro, D, Martín, ME, Guerra, N, Salinas, M and González, VM (2007) Calpain inhibition stimulates caspase-dependent apoptosis induced by taxol in NIH3T3 cells. Exp Cell Res 313, 369-79
Crossref   Medline   1st Citation  

Polster, BM, Basanez, G, Etxebarria, A, Hardwick, JM and Nicholls, DG (2005) Calpain I induces cleavage and release of apoptosis-inducing factor from isolated mitochondria. J Biol Chem 280, 6447-54
Crossref   Medline   1st Citation  

Rami, A (2003) Ischemic neuronal death in the rat hippocampus: the calpain calpastatin-caspase hypothesis. Neurobiol Dis 13, 75-88
Crossref   Medline   1st Citation  

Rhoads, RP, Fernyhough, ME, Liu, X, McFarland, DC, Velleman, SG and Hausman, GJ (2009) Extrinsic regulation of domestic animal-derived myogenic satellite cells II. Dom Anim Endocrinol 36, 111-26
Crossref   1st Citation   2nd  

Rossi, D and Gaidano, G (2003) Messengers of cell death: apoptotic signaling in health and disease. Haematologica 88, 212-8
Medline   1st Citation  

Schamberger, CJ, Gerner, C and Cerni, C (2005) Caspase-9 plays a marginal role in serum starvation-induced apoptosis. Exp Cell Res 302, 115-28
Crossref   Medline   1st Citation  

Scoltock A, B and Cidlowski, JA (2004) Activation of intrinsic and extrinsic pathways in apoptotic signaling during UV-C-induced death of Jurkat cells: the role of caspase inhibition. Exp Cell Res 297, 212-23
Crossref   Medline   1st Citation  

Shi, Y (2002) Mechanisms of caspase activation and inhibition during apoptosis. Mol Cell 9, 459-70
Crossref   Medline   1st Citation  

Shi, YG (2001) A structural view of mitochondria-mediated apoptosis. Nat Struct Biol 8, 394-401
Crossref   Medline   1st Citation  

Slee, EA, Keogh, SA and Martin, SJ (2000) Cleavage of BID during cytotoxic drug and UV radiation-induced apoptosis occurs downstream of the point of Bcl-2 action and is catalysed by caspase-3: a potential feedback loop for amplification of apoptosis-associated mitochondrial cytochrome c release. Cell Death Differ 7, 556-65
Crossref   Medline   1st Citation  

Sordet, O, Rebe, C, Plenchette, S, Zermati, Y, Hermine, O and Vainchenker, W (1999) Distinct caspase cascades are initiated in receptor-mediated and chemical-induced apoptosis. J Biol Chem 274, 5053-60
Crossref   Medline   1st Citation  

Squier, MK, Miller, AC, Malkinson, AM and Cohen, JJ (1994) Calpain activation in apoptosis. J Cell Physiol 159, 229-37
Crossref   Medline   1st Citation  

Strasser, A, O'Connor, L and Dixit, VM (2000) Apoptosis signaling. Annu Rev Biochem 69, 217-45
Crossref   Medline   1st Citation  

Suzuki, K, Hata, S, Kawabata, Y and Sorimachi, H (2004) Structure, activation, and biology of calpain. Diabetes 53, S12-8
Crossref   Medline   1st Citation   2nd  

Vaisid, T, Kosower, NS and Barnoy, S (2005) Caspase-1 activity is required for neuronal differentiation of PC12 cells: cross-talk between the caspase and calpain systems. Biochim Biophys Acta Mol Cell Res 1743, 223-30
Crossref   1st Citation   2nd  

Wang, SJ, Omori, N, Li, F, Jin, G, Zhang, WR and Hamakawa, Y (2002) Potentiation of Akt and suppression of caspase-9 activations by electroacupuncture after transient middle cerebral artery occlusion in rats. Neurosci Lett 331, 115-8
Crossref   Medline   1st Citation  

Wu, M, Yu, Z, Fan, J, Caron, A, Whiteway, M and Shen, SH (2006) Functional dissection of human protease μ-calpain in cell migration using RNAi. FEBS Lett 580, 3246-56
Crossref   Medline   1st Citation  


Received 3 February 2012/10 May 2012; accepted 1 June 2012

Published as Cell Biology International Immediate Publication 1 June 2012, doi:10.1042/CBI20120050


© The Author(s) Journal compilation © 2012 International Federation for Cell Biology


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)