Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Editor-in-Chief
DN Wheatley
(Aberdeen, U.K.)
Co-Editor
Sidney S. Yu
(Shatin, Hong Kong)
Regional Editors
H Carvalho
(Campinas, Brazil)
H Chang Chan
(Shatin, Hong Kong)
C Green
(Auckland, New Zealand)
S Kidson
(Cape Town, South Africa)
E Nadezhdina
(Moscow, Russia)
G Sluder
(Worcester, U.S.A.)
Managing Editor
AJ Panther
(Aberdeen, U.K.)
Cell Biology International (2012) 36, 79–86 (Printed in Great Britain)
ABCC1 polymorphisms in anthracycline-induced cardiotoxicity in childhood acute lymphoblastic leukaemia
Agnes F. Semsei*, Daniel J. Erdelyi*†, Ildiko Ungvari*, Edit Csagoly*, Marta Z. Hegyi†, Petra S. Kiszel*, Orsolya Lautner‑Csorba*, Judit Szabolcs†, Peter Masat‡, Gyorgy Fekete†, Andras Falus*, Csaba Szalai1§¶‖ and Gabor T. Kovacs†
*Department of Genetics, Cell and Immunobiology, Semmelweis University, Budapest, Hungary, †Second Department of Pediatrics, Semmelweis University, Budapest, Hungary, ‡Markusovszky Hospital of Vas County Council, Szombathely, Hungary, §Heim Pal Children Hospital, Budapest, Hungary, ¶Inflammation Biology and Immunogenomics Research Group, Hungarian Academy of Sciences, Semmelweis University, Budapest, Hungary, and ‖Csertex Research Laboratory, Budapest, Hungary


1To whom correspondence should be addressed (email genomika.cs@gmail.com).


This supplementary data is also available as a PDF

SUPPLEMENTARY ONLINE DATA

1. Method for DNA isolation from old bone marrow smears

Isolation of nucleic acids from old bone marrow smears was performed according to HighPure PCR Template Preparation Kit (Roche Diagnostics) 2.7 protocol with the following minor alterations: (i) re-suspend the cells in 200 μl of PBS; (ii) add 40 μl of proteinase K; and (iii) incubate for 2 h at 55°C. The following steps were same as in the HighPure PCR Template Preparation Kit (Roche Diagnostics) 2.7 protocol from step 6.

2. Method for testing ABCC1 rs45511401 polymorphism

ABCC1 rs45511401G/T genotypes were determined by single base extension method. We used 20 ng of genomic DNA per sample in a total volume of 20 μl containing 2.5 mM MgCl2 (Applied Biosystems), 250 μM of each dNTP (Promega), 0.25 pmol/μl of the PCR primers, and 0.1 unit of AmpliTaq Gold polymerase (Applied Biosystems) in the PCR buffer (Applied Biosystems). The PCR reaction began with an initial denaturation step at 95°C for 10 min, followed by 35 cycles of 94°C for 30 s, 56°C for 30 s and 72°C for 60 s, a final extension at 72°C for 5 min was also performed. Electrophoresis was carried out by an Agilent lab-on-chip instrument.

The sequences of primers are shown in Table S1.


Table S1 Sequences of oligonucleotides used for genotyping ABCC1 SNP

Oligonucleotide Primer name Sequence
rs215060  PCR primer 1  AGTGTGAAGGGACTGGGG
 PCR primer 2  ACSTAATAAATCTTATCTGCATGACC
 SNP primer  ACAACTACCGACGACAAGACTGTTTTGAAGATATCCCCTGTCTGC
rs246219  PCR primer 1  ATTGTCAAGGCAACGAAAG
 PCR primer 2  TTCCTTCACCTTGCTGGTC
 SNP primer  AAGTACCACGTCAACGTCACGAGAAGCATGGTTCAAGGCCACTGC
rs246221  PCR primer 1  CTTGGAACTCTCTTTCGGC
 PCR primer 2  ACAACGGCTTCACCTCCT
 SNP primer  CAGAATAGCCACGCCTAGATGGGCAGGATCCTTGGAGGAGTACAC
rs45511401  PCR primer 1  GGAATGTTGAGGCCTTCAGT
 PCR primer 2  GCTTTTCCTCAGACCACCAG
 SNP primer  GACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACTGACCAGGTTCACTGTTTCTCCAA
rs4148358  PCR primer 1  AACCTATCTGGGGCCAAG
 PCR primer 2  AGGCTACTTTTAGGTGACAATACC
 SNP primer  CAAGACCGCAACTAGATACAATTTTTTGCTCACCTGGACGGAAGG
rs11864374  PCR primer 1  TGTCTGTTCCTGGCTTCTTC
 PCR primer 2  TAACTTCTCTGGCTTCCTGG
 SNP primer  CTAACTAAGCTACGCCGACATTAACTTGTCATCAGAGTCAGGACC
rs6416666  PCR primer 1  AGAAGACTCTCCATCTGTGGG
 PCR primer 2  AACAAAAAGCATCAATAGCAGC
 SNP primer  CACCGCTATCAACAGACTTGAATTAACGCCCGTGCCGCCACCCAG
rs3743527  PCR primer 1  TTCATTTCCTTGGGGCTG
 PCR primer 2  AAGACCAGATGTTGGTAAGAGG
 SNP primer  ACGTAAGACCACTCAAGACCTCCAGGGCCCTGGGACACTGCCAAG
rs212097  PCR primer 1  RCACACTGGGCTCTCACA
 PCR primer 2  CATGACCAGAACCCTGTGG
 SNP primer  CAGTCAACAATCCAGATCAATGCCGAGAGCCTGGGCTGGTGTCCA



Unincorporated dNTPs and primers were degraded in a final volume of 5 μl containing 3 μl of PCR product, 0.2 unit of SAP (shrimp alkaline phosphatase) (USB Europe GmbH) and 0.085 unit of exonuclease I (USB). The mixture was incubated at 37°C for 1 h, and then the enzymes were inactivated at 75°C for 15 min.

The treated PCR products were subjected to multiplex mini-sequencing. The reaction mix contained 1.5 μl of the treated PCR product, 0.1 pmol/μl of the mini-sequencing SNP primer, 2.5 μl of SNaPshot Multiplex Ready Reaction Mix (Applied Biosystems) in a total volume of 5 μl. The PCR reaction was performed as follows: 25 cycles of 96°C for 10 s, 50°C for 10 s and 72°C for 10 s.

The unincorporated fluorescent ddNTPs were degraded by the addition of 1 unit of SAP at 37°C for 1 h, and then the enzyme was inactivated at 75°C for 15 min, than 0.7 μl of the digested product was added to 9 μl of HiDi formamide and 0.5 μl of GeneScan-120 LIZ size standard (Applied Biosystems). The electrophoresis was performed for 17 min with ABI 310 Genetic Analyzer (Applied Biosystems). The runs were analysed with Genotyper software (Applied Biosystems) and a homemade template. The relative position of each peak indicated the SNP (single nucleotide polymorphism) locus, and the peak colour indicated the specific genotype.

Genotype findings were verified for the ABCC1 polymorphism on two samples for each genotype by single PCR followed by bidirectional sequencing using the BigDye v3.1 kit on an ABI310 sequencer.

3. Genotyping procedure performed in the GenomeLab SNPstream genotyping platform

The ABCC1 rs215060, rs246219, rs246221, rs45511401, rs4148358, rs11864374, rs6416666, rs3743527 and rs212097 SNPs were genotyped using the GenomeLab SNPstream genotyping platform (Beckman Coulter).

The genotyping procedure is described in brief here.

4. SNP selection and primer design

The polymorphisms of the ABCC1 gene were chosen from the Hapmap database (http://hapmap.ncbi.nlm.nih.gov/). For the design of the multiplex PCR, we took into consideration the GC content (40–65%) of the sequence surrounding the SNP and we masked the repeat sequences. For the design of PCR and extension primers, we used the Autoprimer software (http://www.autoprimer.com) (Beckman Coulter). We chose SNPs with minor allelic frequencies of >10% and because of the specialty of our genotyping system we selected SNPs which could be genotyped simultaneously with one multiple measurement. The sequences of the primers are shown in Table S1.

5. PCR, clean up and extension

We performed the PCR in the final volume of 5 μl containing 20 ng of genomic DNA, 5 mM MgCl2 (Applied Biosystems), 90 μM of each dNTP (Invitrogen), 50 nM of each PCR primer, 0.1 unit/μl AmpliTaq Gold polymerase (Applied Biosystems) and PCR buffer (Applied Biosystems). We used the following PCR conditions: initial denaturation step at 94°C for 60 s, and 40 cycles of 94°C for 30 s, 55°C for 30 s and 72°C for 60 s.

PCR products were purified from unincorporated dNTPs and primers with 3 μl of SBE Cleanup Reagent (USB), which contains exonuclease I and SAP. We incubated this reaction mix at 37°C for 30 min and we inactivated the enzymes at 96°C for 10 min.

The single base primer extension reaction was carried out adding the total volume of 7 μl of extension reaction mix to each well. This consisted of 3.76 μl of SNPware Extension Dilution Buffer (Beckman Coulter), 0.2 μl of SNPware Extension Mix (Beckman Coulter), 2.97 μl of Ultrapure DNAse/RNAse-Free distilled water (Invitrogen), 0.02 μl of SNPware DNA polymerase (Beckman Coulter) and contains 5 μM of each SNP primers. The SNPware Extension Mix contains (TAMRA and Bodipy-fluorescein labelled) dye-labelled dideoxynucleotides, these incorporate into the 3′-terminus of the 5′-end tagged extension primers according to the presence of the allele in the analysed genome. The extension PCR conditions were 96°C for 3 min, and 46 cycles of 94°C for 20 s, 40°C for 11 s.

All the above-mentioned reactions were run in a PKGD PTC 0220 DNA Engine Dyad thermal cycler (BioRad).

6. Hybridization and plate reading

The oligonucleotide arrayed 384-well SNPware plate (Beckman Coulter) was pre-washed with 1×SNPware Wash Buffer 1 (Beckman Coulter) for activation.

After the primer extension, 8 μl of hybridization mix (Beckman Coulter) was added to the extension PCR product and 20 μl of this mixture was transferred to the SNPware plate. This was incubated in 100% humidity in a sealed chamber at 42°C for 2 h. The dye and tag-labelled extension primers were hybridized to the complementary oligonucleotides on the plate.

After the incubation the SNPware plate was washed with 1×SNPware Wash Buffer 2 (Beckman Coulter) to remove the not arrayed primers. The plate was imaged in GenomeLab SNPStream Imager (Beckman Coulter) and analysed with the software provided.


Received 2 May 2011/7 July 2011; accepted 20 September 2011

Published as Cell Biology International Immediate Publication 20 September 2011, doi:10.1042/CBI20110264


© The Author(s) Journal compilation © 2012 Portland Press Limited


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)