Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2012) 36, 267–271 (Printed in Great Britain)
Wnt3a is involved in the early stage of miPSC and mESC haemopoietic differentiation
Wencheng Zhang, Hailei Yao, Sihan Wang, Shuangshuang Shi, Yang Lv, Lijuan He, Xue Nan, Wen Yue, Yanhua Li1 and Xuetao Pei1
Stem Cell and Regenerative Medicine Lab, Beijing Institute of Transfusion Medicine, Beijing 100850, Peoples Republic of China


1Correspondence may be addressed to either of these authors (email shirlylyh@126.com or peixt@nic.bmi.ac.cn).


This supplementary data is also available as a PDF

SUPPLEMENTARY ONLINE DATA



Figure S1 Constructing and packaging of pBPLV-Wnt3a plasmid

Top panels, generation of the lentiviral plasmid with Wnt3a. Wnt3a gene sequence was inserted into GFP-labelled pLentiviral vector in the Xba-1 enzyme site. Bottom panels, virus packaging of pBPLV-Wnt3a pLentiviral vector in 293FT cells. GFP expression reflected virus production in the packaging cells. Scale bar = 150 μm.



Figure S2 Generating Wnt3a-OP9 cell line through LV-Wnt3a infection

Left-hand panels, Wnt3a-OP9 cell line was generated using LV-Wnt3a infection. The cells were then sorted according to the expression of GFP. Scale bar = 100 μm. Right-hand panel, RT–PCR results for the expression of Wnt3a gene in Wnt3a-OP9 cells in contrast with control OP9 cells.


Table S1 Description of primers used for RT–PCR analysis

Gene Forward Reverse
Oct4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAAC
Sox2 GGGAAATGGGAGGGGTGCAAAAGAGG TTGCGTGAGTGTGGATGGGATTGGTG
Brachyury AATGGGGGTGGCTTGTTCCT AGGCTTTGGGCCGTGTCATA
Gata1 CATTGGCCCCTTGTGAGGCCAG CGCTCCAGCCAGATTCGACCC
Sca1 TCTGAGGATGGACACTTCTC CTCAGGCTGAACAGAAGCAC
Wnt3a AGCGCTATGGCCCCACTCGGATACT GCTAGCCTACTTGCAGGTGTGCTGC
GAPDH TTGCGTGAGTGTGGATGGGATTGGTG TTGCGTGAGTGTGGATGGGATTGGTG



Received 30 October 2010/22 August 2011; accepted 17 October 2011

Published as Cell Biology International Immediate Publication 17 October 2011, doi:10.1042/CBI20100766


© The Author(s) Journal compilation © 2012 Portland Press Limited


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)