Brought to you by Portland Press Ltd.
Published on behalf of the International Federation for Cell Biology
Cancer Cell death Cell cycle Cytoskeleton Exo/endocytosis Differentiation Division Organelles Signalling Stem cells Trafficking
Cell Biology International (2012) 36, 537–543 (Printed in Great Britain)
Replacement of mouse embryonic fibroblasts with bone marrow stromal cells for use in establishing and maintaining embryonic stem cells in mice
Chae Hyun Lee*, Jun Hong Park*, Jae Hee Lee†, Ji Yeon Ahn†, Jong Heum Park*, Bo‑Ram Lee‡, Dae Yong Kim‡ and Jeong Mook Lim*†1
*Department of Agricultural Biotechnology, Seoul National University, Seoul 151921, Korea, †Laboratory of Stem Cell and Bioevaluation, WCU Biomodulation Program, Seoul National University, Seoul 151742, Korea, and ‡Department of Veterinary Pathology, College of Veterinary Medicine, Seoul National University, Seoul 151742, Korea


1To whom correspondence should be addressed (email limjm@snu.ac.kr).


This supplementary data is also available as a PDF

SUPPLEMENTARY ONLINE DATA


Table S1 Oligonucleotide primer sequences and thermal cycling conditions used in real-time and RT–PCR

Primer sequence
Genes GenBank® number Sense (5′>3′) Antisense (5′>3′) Size (bp) Temperature (°C)
β-actin X03672 TACCACAGGCATTGTGATGG TCTTTGATGTCACGCACGATT 200 60
Oct-4 M34381 GAAGCCCTCCCTACAGCAGA CAGAGCAGTGACGGGAACAG 297 60
Nanog AY455282 CCCCACAAGCCTTGGAATTA CTCAAATCCCAGCAACCACA 255 60
H-dac AF125536 ATTCGAGGACATGGGGAATG GGTGCTGACATCTGGATGGA 219 60
Dnmt3b AF151973 AGTCCATCGTGTGGGAACT GGGCGGGTATAATTCAGCAA 226 60
Tert AF051911 GGATCCTGGCTACGTTCCTG TGCCTGACCTCCTCTTGTGA 208 60
Lif NM_008501.2 TGGGCAAAACTGATTCCTTC ACCACAGCTTCCTGGTCTGT 241 60
Rex1 M28382 ACATCCTAACCCACGCAAAG TGATTTTCTGCCGTATGCAA 294 60
Cripto M87321 CTTTAAGCAGGGAGGTGGTG TAAAGCCATCTGCCACAATG 195 60
Sox2 AB108673 ACGCTCATGAAGAAGGATAA GTAGGACATGCTGTAGGTGG 345 60
Gdf3 BC101963 CGAGTTTCAAGACTCTGACC TAGAGGACCTTCTGGAGACA 276 60



Received 22 July 2011/28 November 2011; accepted 6 February 2012

Published as Cell Biology International Immediate Publication 6 February 2012, doi:10.1042/CBI20110395


© The Author(s) Journal compilation © 2012 International Federation for Cell Biology


ISSN Print: 1065-6995
ISSN Electronic: 1095-8355
Published by Portland Press Limited on behalf of the International Federation for Cell Biology (IFCB)